2.1 Animals

All animal experiments were conducted in accordance with the ethical guidelines approved by the Institutional Animal Care and Use Committee (IACUC) of Tsinghua University (Approval No. 13-LZH1) and complied with relevant national and international guidelines governing the use of laboratory animals. Male C57BL/6J mice (8–12 weeks old) were housed under specific pathogen-free (SPF) conditions in a controlled environment (21 ± 1 °C, 50 ± 10% humidity, 12 h light/12 h dark cycle) with free access to standard rodent diet and autoclaved water. Animal group assignments and sample sizes for each experiment are detailed in the corresponding figure legends. Adult (8–12 weeks) male and female CX3CR-1GFP mutant mice (Stock# 005582, Jackson Laboratories) were used for this study. PbsnCre; Ptenf/f mice were generously provided by Professor Geng Liu from Nanjing University.

2.2 Cells

RM-1: The castration-resistant prostate cancer (CRPC) cell line RM-1 (Cat# CL-0198, Pricella Life Science & Technology, Wuhan, China) was cultured in Dulbecco’s Modified Eagle Medium (Cat# 11965092, Gibco, New York, USA) supplemented with 10% fetal bovine serum (FBS, Cat# 10091148, Gibco, Auckland, New Zealand) and 1% penicillin/streptomycin (Cat# 15140122, Gibco, New York, USA). Cells were maintained at 80–90% confluence and routinely passaged using 0.25% trypsin (Cat# 15090046, Gibco, New York, USA).

Raw264.7: Mouse monocyte-macrophage leukemia cell line (Cat# CL-0190, Pricella Life Science & Technology, Wuhan, China) was cultured in RPMI 1640 (Cat# 11875093, Gibco, New York, USA) supplemented with 10% fetal bovine serum (FBS, Cat# 10091148, Gibco, Auckland, New Zealand) and 1% penicillin/streptomycin (Cat# 15140122, Gibco, New York, USA). Cells were maintained at 80–90% confluence and routinely passaged using 1–3 mL of complete culture medium to dislodge adherent cells from the flask walls.

Bone Marrow-Derived Macrophages (BMDM)

BMDMs were isolated from 8- to 12-week-old male C57BL/6J wild-type (WT) or Cx3cr1−/− mice. Briefly, bone marrow cells were flushed from femurs with cold PBS, followed by erythrocyte lysis (Cat# 00-4333-57, Gibco, California, USA), and filtration through a 70 μm cell strainer (Cat# BS-70-CS, Biosharp, Anhui, China). The cells were then differentiated into BMDMs by culturing for 7 days in RPMI 1640 medium supplemented with 10% FBS, 1% penicillin/streptomycin, and 20 ng/mL recombinant M-CSF (Cat# 315-02-1MG, PeproTech, New Jersey, USA) at 37 °C under 5% CO₂.

For stimulation experiments, BMDMs were treated with 100 ng/mL recombinant Fractalkine/CX3CL1 (Cat# HY-P72686, MCE, USA) for 2 h in RPMI 1640 containing 10% FBS, 1% penicillin/streptomycin, and 20 ng/mL M-CSF. Subsequently, cells were exposed to either 100 ng/mL LPS (Cat# 437627, Sigma–Aldrich, USA) or 20 µg/mL IL-4 (Cat# ab9729, Abcam, USA), and RNA was extracted 24 h later.

2.3 siRNA transfection

RM-1 cells were transfected with siRNA using Lipofectamine 2000 (Cat# CA92008, Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Briefly, cells were seeded in 12-well plates at a density of 2 × 10⁵ cells per well and cultured overnight to reach 60–70% confluence. For each well, 97.5 µL of RPMI 1640 medium was mixed with 2.5 µL of Lipofectamine 2000 reagent. Simultaneously, 97.5 µL of RPMI 1640 was mixed with 2.5 µL of Cx3cl1 siRNA (Cat# HY-RS16603, MCE, USA) or negative control siRNA. The Lipofectamine 2000 mixture and siRNA mixture were then combined and incubated at room temperature for 15–20 min to allow complex formation. The transfection complexes (200 µL total volume) were added dropwise to cells in fresh culture medium. The cells were incubated at 37 °C in a humidified atmosphere with 5% CO₂. The transfection efficiency was assessed at 12- and 24-hours post-transfection by RT–qPCR analysis of target gene expression, and cells were then harvested for subsequent experiments.

2.4 Orthotopic and ectopic RM-1 tumor models

For in vivo studies, RM-1 cells were harvested, washed, and resuspended in phosphate-buffered saline (PBS) at a density of 2 × 10⁶ cells/mL. In the ectopic tumor model, 100 µL of cell suspension (containing 2 × 10⁵ cells) was injected subcutaneously into the left flank of anesthetized C57BL/6J mice. For the orthotopic model, a midline laparotomy was performed to expose the ventral prostate, and 20 µL of cell suspension (1 × 10⁵ cells) was injected into the prostate capsule using a 30-gauge needle. The abdominal wall was sutured with 5 − 0 silk, and mice were monitored until recovery. All animals were euthanized three weeks post-injection; tumors were excised, and volumes were calculated as (length × width²) / 2.

2.5 In vitro migration assay (Transwell chamber assay) BMDM migration

To assess the role of CX3CR1 in macrophage migration, a transwell chamber assay (Cat# GLS3422, Corning, New York, USA) was performed. A total of 2 × 10⁵ WT or Cx3cr1−/− BMDMs in 200 µL serum-free RPMI 1640 (Cat# 11875093, Gibco, New York, USA) were seeded into the upper chamber, while the lower chamber contained 600 µL of conditioned medium from RM-1 cells. After 2 h of incubation at 37 °C, migrated cells in the lower chamber were collected and quantified using a Z2 Coulter Counter (Cat# C19196, Beckman Coulter, California, USA).

RAW264.7 migration

To assess the role of CX3CL1 in macrophage migration, transwell assays were performed using inserts (Cat# GLS3422, Corning, New York, USA). RAW264.7 cells (2 × 10⁵) suspended in 200 µL serum-free RPMI 1640 (Cat# 11875093, Gibco, New York, USA) were seeded into the upper chamber, while 600 µL of conditioned medium from RM-1 cells transfected with control or Cx3cl1 siRNA was added to the lower chamber. After incubation for 12–24 h at 37 °C, migrated cells in the lower chamber were collected and quantified using a Z2 Coulter Counter (Cat# C19196, Beckman Coulter, California, USA).

2.6 Quantitative real-time PCR

Total RNA was extracted using Trizol reagent (Cat# 15596026CN, Invitrogen, California, USA) according to the manufacturer’s protocol. cDNA was synthesized using the PrimeScript RT Reagent Kit (Cat# RR037A, TaKaRa, Dalian, China). Quantitative PCR was performed using SYBR Premix Ex Taq (Cat# RR420A, TaKaRa, Dalian, China) on an ABI7500 Real-Time PCR system (Cat# ABI7500, Life Technologies, California, USA). Thermal cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. Gene expression was normalized to Gapdh and analyzed using the 2–ΔΔCt method. The sequences of the primers used are listed below:

Gapdh

Forward 5′–GGTCCTCAGTGTAGCCCAAG–3′, Reverse 5′–AATGTGTCCGTCGTGGATCT–3′.

iNos

Forward 5′–CAGAGGACCCAGAGACAAGC–3′, Reverse 5′–TGCTGAAACATTTCCTGTGC–3′.

Cd163

Forward 5′–TCCACACGTCCAGAACAGTC–3′, Reverse 5′–CCTTGGAAACAGAGACAGGC–3′.

Cd80

Forward 5′–GGCAAGGCAGCAATACCTTA–3′, Reverse 5′–CTCTTTGTGCTGCTGATTCG–3′.

Cd206

Forward 5′–CAGGTGTGGGCTCAGGTAGT–3′, Reverse 5′–TGTGGTGAGCTGAAAGGTGA–3′.

Arg1

Forward 5′–CTCCAAGCCAAAGTCCTTAGAG–3′, Reverse 5′–AGGAGCTGTCATTAGGGACATG–3′.

2.7 Flow cytometry

Tumor tissues were minced and dissociated enzymatically in a digestion cocktail containing 2 mg/mL collagenase type IV (Cat# 17104019, New York, Gibco, USA) and 1 U/µL DNase I (Cat# 18047019, California, Sigma-Aldrich, USA) at 37 °C for 30–45 min. Single-cell suspensions were obtained by filtering through a 70-µm cell strainer (Cat# BS-70-CS, Biosharp, Anhui, China) and subjected to red blood cell lysis using RBC Lysis Buffer (Cat# 420302, Biolegend, California, USA). After washing, cells were resuspended in FACS buffer (PBS containing 2% FBS) and stained with the following fluorescently conjugated antibodies for 30 min at 4 °C in the dark: anti-CD11b-FITC (Cat# 554982, BD Biosciences, New Jersey, USA) and anti-F4/80-APC (Cat# MA5-16625, eBioscience, California, USA). Following two rinses, cells were resuspended in PBS and analyzed on a BD FACS Canto II flow cytometer (BD Biosciences, New Jersey, USA). Data analysis was performed using FlowJo software (v.10.8.1, Tree Star, Oregon, USA).

2.8 Immunohistochemical staining

For immunohistochemical analysis, 6-µm-thick sections from paraffin-embedded tissues were deparaffinized and rehydrated. Antigen retrieval was conducted using citrate buffer (pH 6.0) in an electric steamer. Subsequent staining steps were carried out in accordance with the instructions of the immunohistochemistry kit (Cat# SPN-9002, ZSGB-BIO, Beijing, China). Briefly, endogenous peroxidase activity was blocked with 3% hydrogen peroxide for 15 min, and non-specific binding sites were blocked with 10% normal goat serum for 30 min at room temperature. Sections were then incubated overnight at 4 °C with primary antibodies against Ki67 (1:500; Cat# ab15580, Abcam, USA) or cleaved caspase-3 (1:400; Cat# 9664s, Cell Signaling Technology, USA). After washing, sections were incubated with a biotinylated secondary antibody (Cat# 31460, Invitrogen, USA) for 1 h at room temperature, followed by detection using a streptavidin-biotin-peroxidase complex and a 3,3′-diaminobenzidine (DAB) substrate kit (Cat# PV-6000D, ZSBIO, Beijing, China). Finally, sections were counterstained with hematoxylin, dehydrated through a graded ethanol series, cleared in xylene, and mounted with neutral balsam (Cat#G8590, Solarbio, Beijing, China). Images were acquired using a Nikon Eclipse Ti-S microscope equipped with a DS-Ri2 camera.

2.9 Immunofluorescence staining

For in vitro immunofluorescence, RM-1 cells were plated on glass coverslips at 5 × 10⁴ cells/well, adhered for 24 h, and serum-starved for another 24 h. Cells were fixed in 4% PFA for 10 min, permeabilized with 0.1% PBST, and blocked with 10% goat serum. Subsequent incubations included primary antibodies overnight at 4 °C and fluorophore-conjugated secondary antibodies (1:1000, Cat# 31460, Invitrogen, USA) for 1 h at room temperature. Nuclei were stained with DAPI before mounting with Fluoromount-G (Cat# 010001, SouthernBiotech, Alabama, USA).

For multiplex immunofluorescence staining of paraffin-embedded tissue sections, a tyramide signal amplification (TSA) staining kit (Cat# NECC4100, Histova Biotechnology, Beijing, China) was employed. Sections (6-µm thick) were deparaffinized, rehydrated, and subjected to antigen retrieval. After blocking, samples were incubated overnight at 4 °C with primary antibodies, followed by appropriate secondary antibodies and TSA reagent according to the manufacturer’s protocol. Antibody complexes were eluted between successive staining cycles to enable sequential labeling of multiple antigens. Nuclei were counterstained with DAPI, and slides were mounted with Fluoromount-G (Cat# 010001, SouthernBiotech, Alabama, USA). Imaging was performed using a confocal laser scanning microscope (Nikon A2, Japan). The following primary antibodies were used: anti-F4/80 (1:200, Cat# 70076, Cell Signaling Technology, USA), anti-CD206 (1:300, Cat# 24595, Cell Signaling Technology, USA), anti-CX3CR1 (1:250, Cat# ab250888, Abcam, USA), anti-CX3CL1 (1:200, Cat# 67735-1-Ig, Proteintech, Wuhan, China), anti-CD80 (1:300, Cat# 98958, Cell Signaling Technology, USA), anti-Ki67 antibody (1:500, Cat# ab15580, Abcam, USA), and anti-SOX9 antibody (1:400, Cat# 82630, Cell Signaling Technology, USA), anti-Epcam antibody (1:200, Cat# 21050-1-AP, Proteintech, USA), anti-CD4 antibody (1:200, Cat# 25229, Cell Signaling Technology, USA), anti-CD8 antibody (1:500, Cat# 98941, Cell Signaling Technology, USA), and anti-CD3 antibody (1:500, Cat# 78588, Cell Signaling Technology, USA).

2.10 Public data acquisition and processing

Publicly available genomic datasets were obtained from the following sources: single-cell RNA sequencing (scRNA-seq) data from the Gene Expression Omnibus (GEO) and the Broad Institute Single Cell Portal; bulk RNA sequencing data from The Cancer Genome Atlas Prostate Adenocarcinoma (TCGA-PRAD) cohort via the UCSC Xena browser.

Human datasets: The study incorporated the following human prostate cancer cohorts: [1] GSE181294, containing scRNA-seq data from 18 untreated primary prostate tumors and 5 benign prostate samples; [2] GSE274229, comprising scRNA-seq profiles from 6 metastatic castration-resistant (mCRPC), 25 metastatic hormone-sensitive (mHSPC), and 13 localized prostate cancer samples; [3] SCP1415, a scRNA-seq cohort of human prostate tumors; and [4] TCGA-PRAD, including bulk RNA-seq data from 501 primary tumors and 52 matched normal tissues.

Mouse datasets: Mouse scRNA-seq datasets included: [1] GSE146811, representing healthy prostate tissues under androgen manipulation; and [2] GSE262893, containing profiles from a murine prostate cancer model.

All datasets were processed using standardized quality control, normalization, and analysis pipelines appropriate for each data type before integrative analysis.

2.11 scRNA-seq data analysis

Analysis of scRNA-seq data was conducted using the Seurat package (v4.3.0) in R. Low-quality cells and doublets were filtered out using DoubletFinder (v2.0.3). Following normalization and scaling, principal component analysis (PCA) was performed for dimensionality reduction. The top significant principal components were selected for subsequent uniform manifold approximation and projection (UMAP) visualization and graph-based clustering. Cell types were annotated according to established marker genes. Differential expression analysis between defined cell clusters or conditions was carried out using the FindMarkers function with a Wilcoxon rank-sum test. Gene set enrichment analysis (GSEA) and gene ontology (GO) enrichment analysis were performed using the clusterProfiler package (v4.12.6). Cell-cell communication analysis was inferred using CellChat (v1.6.1). Immunosuppression signature scores were computed for individual cells using the Seurat “AddModuleScore” function, based on a curated gene set derived from published immunosuppression-related signatures [26].

2.12 Quantification and statistical analysis

All experiments were performed with at least three independent biological replicates, as indicated in the figure legends. Statistical analyses were conducted using R software and GraphPad Prism 8. Data normality was assessed using the Shapiro-Wilk test. Normally distributed data are presented as mean ± Standard Error of the Mean (SEM), and non-normally distributed data are expressed as median with interquartile range. Comparisons between two groups were performed using an unpaired two-tailed Student’s t-test (for parametric data) or the Mann-Whitney U test (for non-parametric data). Comparisons between three or more groups were performed using Tukey’s multiple comparisons test. Statistical significance was defined as a p-value ≤ 0.05. Exact p-values are provided in the figures and figure legends.