Lysosomal channel TPC2 modulates microglia-endothelial signaling in choroidal angiogenesis

Mice

WT C57BL/6J and Tpc2−/− animals were raised in 12-hour (h) light-dark cycles with food (Ssniff; regular feed: R/M-H; breeding feed: M-Z Extrudat) and water. Tpc2⁻/⁻ mice were originally generated as describe [18] and were backcrossed onto a C57BL/6J background for more than 10 generations. WT mice are derived from subsequent heterozygous breedings within the same colony, and they are frequently refreshed.

Choroidal sprouting assay

Choroidal sprouting assay was carried out as previously described [19] with slight modifications. Briefly, pieces of the RPE/choroid/sclera complex were dissected from peripheral region of eyes of post-natal ages (P)25–35 mice, cut into 1 × 1-mm fragments and then embedded in growth factor-reduced Matrigel (Cat.354230, Corning, USA) in 24-well plates. The Matrigel was allowed to solidify for approximately 20 min (min) at 37 °C before adding culture medium. Then the explants were cultured in EBM-2 complete medium consisting of EBM-2 Basal Medium (Cat. CC-3156, Lonza, Switzerland) supplemented with the Microvascular Endothelial SingleQuots kit (Cat. CC-4177, Lonza, Switzerland), which contains 5% fetal bovine serum (FBS), VEGF (50 ng/mL), hFGF-B (10 ng/mL), R3-IGF-1 (50 ng/mL), hEGF (50 ng/mL), hydrocortisone (0.4 µM), ascorbic acid (50 µg/mL), heparin (10 µg/mL), and 1%GA-1000 (Antibiotic-Antimycotic). Culture was maintained at 37 °C with 5% CO2 for 6 days. In pharmacological experiments, tissue pieces were cultured for 4 h in full medium once embedded in Matrigel. Thereafter, medium was replaced with fresh medium containing 10 µM SG-094, 5 µM TPC2-A1P (kindly provided by Prof. Franz Bracher) or 200 ng/mL CHIL3 (Cat. HY-P7845, MCE, USA). Images of tissue pieces were taken with EVOS M5000 microscope (Thermo Fisher Scientific, USA) on specific days. Sprouting areas were analyzed using the ImageJ software (National Institutes of Health, USA) with SWIFT-choroid macros developed by Z Shao and M Friedlander [19].

Cell line culture

BV2 murine microglial cell line (Accegen Biotechnology, USA) and RAW264.7(ATCC, USA) murine macrophage cell line were maintained in DMEM+GlutaMAX (Cat. 31966021, Gibco) supplemented with 10% FBS (Thermo Fisher Scientific, USA) and 1% penicillin/streptomycin (P/S; Gibco). Cells were cultured at 37 °C in a humidified incubator with 5% CO₂ and passaged upon reaching approximately 80–90% confluence. Culture medium was replaced every 2–3 days.

Primary choroidal vascular cell culture

Primary choroidal vascular cells (pCVCs) were isolated from sprouting choroid explant cultures as described above. 200 µL 0.25% trypsin-EDTA (Cat. 25200056, Gibco, USA) was added to each well after 7–10 days of culturing. After 5-min incubation at 37 °C, 300 µL pre-warmed EBM-2 complete medium was added and the tissue/Matrigel complex was pipetted up and down vigorously to create single-cell suspension before passing the solution through a 100 μm cell strainer (Cat. 732–2759, VWR, USA). The cell-strainer was then rinsed with media, and the cells were centrifuged for 5 min at 400×g. The media was aspirated, and the cell pellet resuspended again and transferred into an appropriate culture flask. Cells were cultivated in EBM-2 complete medium as described above. All experiments were performed using passage 1 (P1) cells.

Primary retinal microglia culture

Primary retinal microglia-enriched (pRMG) culture were isolated from (P)25–35 WT and Tpc2⁻/⁻ mice using a papain-based enzymatic dissociation protocol. Typically, retinas from 4 to 5 mice were pooled to obtain enough microglia cells. Mice were sacrificed, and eyes were enucleated immediately. Under a stereomicroscope, retinas were carefully dissected and enzymatically digested for 15 min at 37 °C according to Feodorova et al. [20] with minor modifications. The suspension was filtered through a 40-µm cell strainer and plated into an appropriate culture flasks. The culture medium was based on DMEM-Ham’s F-12 (Thermo Fisher Scientific, USA), 10% FBS, 0.45% D-(+)-glucose (Sigma-Aldrich, USA), 1.5 µg/mL ovine wool cholesterol (Sigma Aldrich, USA), 1× GlutaMAX (Thermo Fisher Scientific, USA), 1 ng/mL murine granulocyte-macrophage colony-stimulating factor (GM-CSF; PeproTech, USA), and 1× P/S. Mixed glial cultures were maintained at 37 °C in a humidified 5% CO₂ incubator, with half of the medium replaced every 3–4 days. After 4–6 weeks in vitro, the cultures were enriched for retinal microglia. Adherent astrocytes/Müller glia were removed by incubation for 5 min at 37 °C with 0.08% Trypsin-EDTA in Phosphate-buffered saline (PBS), exposing microglia cells firmly attached to the bottom of the flask. Afterwards pRMG were collected by scraping with a cell scraper. After centrifugation for 5 min at 300×g, cells were carefully resuspended in microglia medium, counted and seeded at a density of 80,000–100,000 cells/well in a 24-well. For subsequent immunostaining, glass coverslips coated with 20 µg/mL Poly-D-Lysine (PDL; Sigma-Aldrich, USA) in PBS were placed in the wells prior to seeding.

Flow cytometry analysis

Primary mouse choroidal vascular cells were detached using 0.25% trypsin-EDTA at 37 °C for 5 min. The resulting cell suspension was passed through a 100-µm cell strainer and centrifuged at 400×g for 5 min to collect the choroidal vascular cells. Endothelial cells were identified by staining with phycoerythrin (PE)-conjugated anti-Endomucin antibody (1:100, Cat. 2647665, Invitrogen, USA) and allophycocyanin (APC)-conjugated anti-CD31 antibody (1:100, Cat. 551262, Invitrogen, USA). Adherent retinal microglia were detached from the culture plate using a cell scraper and centrifuged at 300×g for 5 min. Microglia were then labeled with Phycoerythrin–Cyanine7 (PE-Cy7)-conjugated anti-CD45 antibody (1:100, Cat. 2629030, Invitrogen, USA) and APC-conjugated anti-CD11b antibody (1:100, Cat. 2629033, Invitrogen, USA). After 1 h of staining at 4 °C in the dark, cells were washed three times with FACS buffer (2% FBS and 2 mM EDTA in PBS), each washing lasting 10 min. Cell viability was negatively gated on DAPI. Fluorescence intensity was acquired using a flow cytometer (LSRFortessa, BD Biosciences, USA), and data were analyzed with FlowJo software (BD Biosciences, USA).

Tube formation assay

The angiogenic potential of pCVCs and human iPSC-derived endothelial cells was assessed using a tube formation assay on Matrigel. µ-Slide 15 Well angiogenesis chambers (ibidi, Germany) were pre-coated with 10 µL of growth factor-reduced Matrigel per well. The slides were incubated at 37 °C for 20 min. In this way, Matrigel polymerizes and forms a gel-like matrix. Cells were harvested and resuspended in endothelial growth medium at a concentration of 2 × 10⁵ cells/mL. A total of 10,000 cells in 50 µL of EBM-2 complete medium were seeded into each Matrigel-coated well. The slides were then incubated in a humidified CO₂ incubator at 37 °C to allow tube-like structures to form. At the end of the incubation period, images were captured for each well using an EVOS M5000 microscope. Quantitative analysis of tube formation was performed using the Angiogenesis Analyzer plugin [21] in ImageJ software.

Cell migration assay

iPSC-induced endothelial cells (iEC) (WT and TPC2−/−, see detailed generation and differentiation below) were resuspended in complete EGM-2 medium (Promo Cell, Germany) at a final concentration of 5 × 10⁵ cells/mL. A volume of 70 µL of the cell suspension was carefully pipetted into each well of a two-well culture insert (ibidi, Germany) placed in a 6-well plate. Cells were allowed to attach and grow for 4 h at 37 °C in a humidified incubator with 5% CO₂. After this incubation period, the insert was gently removed using sterile forceps, creating a defined, reproducible cell-free gap of approximately 500 μm between the two cell monolayers. The wells were then washed once with pre-warmed PBS to remove any non-adherent cells and replaced with fresh EGM-2 complete medium. Images of the cell-free area were acquired immediately after insert removal (0 h) and at defined time points. The width of the remaining cell-free gap was measured using Cell watcher M (Phio, Germany), and gap closure was quantified by calculating the percentage of the original wound area covered by migrating cells.

Sample preparation for mass spectrometry (MS)

Equal numbers of cells (pRMG or pCVCs from WT and Tpc2⁻/⁻) were seeded and cultured. Cell viability was monitored throughout the experiments and no substantial differences were observed between groups at the time of sample collection.

For cell lysates, cells were harvested by scraping in cold PBS and centrifuged at 300–400×g for 5 min at 4 °C. The cell pellets were lysed in RIPA buffer (Thermo Fisher Scientific, USA) supplemented with a protease and phosphatase inhibitor cocktail (Roche, USA) on ice for 30 min. Lysates were then centrifuged at 14,000×g for 15 min at 4 °C to remove insoluble debris.

For secretome samples, supernatants were collected and centrifuged at 300–400×g for 5 min to remove floating cells, followed by a second centrifugation at 2000×g for 10 min to eliminate cellular debris. The cleared supernatant was then precipitated by adding four volumes of cold acetone and incubating at − 20 °C for overnight to allow protein precipitation. The supernatant samples were centrifuged at 10,000×g for 10 min at 4 °C to pellet the proteins. The protein pellet was washed twice with cold acetone and after drying, the pellet was resuspended in RIPA buffer for further processing.

The protein concentration of cell lysates and supernatant was determined using the BCA protein assay kit (Thermo Fisher Scientific, USA). Protein samples were prepared and digested using the SP3 protocol with paramagnetic beads as previously described [22]. 20 µL carboxylate-coated magnetic beads (1:1 mixture of hydrophilic and hydrophobic beads) were washed manually thrice with 100 µL MS-scale water and the last washing solution was kept within the 96-well plate. Equal amounts of total protein (20 µg) were diluted to 50 µL with PBS buffer and added onto the beads. The mixture was shaken for 1 min at 850 rpm, room temperature (RT). Afterwards 60 µL absolute ethanol was added to each sample and incubated for 5 min at 850 rpm, RT. The supernatants were removed, and the protein-bound beads were washed three times with 100 µL 80% ethanol and once with 100 µL acetonitrile, each followed by a 1-min incubation at 850 rpm at RT. After the final wash, beads were resuspended in 100 µL 100 mM ammonium bicarbonate and digested overnight with 1 µL sequencing-grade trypsin (0.5 mg/20 mL, Promega, USA) at 37 °C, 600 rpm. On the next day, the peptide mixtures were all transferred to new Eppendorf tubes, and the beads were washed with 50 µL and 30 µL 1% formic acid (FA) in water. The beads with washing solutions were incubated at 40 °C, 850 rpm for 5 min. The washing solutions were collected all together with digested peptide mixtures and placed within a MS-vial. For LC-MS/MS measurement, 5 µL solutions were injected for each sample.

LC-MS/MS measurement and data analysis

Peptides were analyzed on an Orbitrap Eclipse Tribrid Mass Spectrometer coupled to an UltiMate 3000 Nano-HPLC system with nanospray ionization and FAIMS. Peptides were loaded onto a C18 precolumn and separated on an in-house packed C18 analytical column using a gradient of water and acetonitrile, both containing 0.1% FA. The mass spectrometer was operated in data-independent acquisition (DIA) mode [23].

Raw files were converted to mzML format using ProteoWizard and analyzed with DIA-NN 1.8.1. Peptides were searched against the Uniprot murine database including contaminants and decoys. The dataset quality metrics including DIA-NN output statistics were assessed and all identified proteins had Q-values below 0.01. Protein intensities were log2-transformed, and only proteins with at least two valid measurements out of three biological replicates were retained. Missing values imputed from normal distribution with 1.8 downwards shift, and differential expression was analyzed using a Student’s t-test with FDR correction. For Venn diagram analysis, protein presence was defined at the group level: a protein was considered detected if identified in at least two out of three biological replicates.

Quantitative reverse transcription PCR (qRT-PCR)

qRT-PCR was performed on an Applied Biosystems QuantStudio 5 system using SYBR Green chemistry for detection. Total RNA was isolated from both choroidal vascular cells and retinal microglia using the Qiagen RNeasy kit (Qiagen, USA), following the manufacturer’s protocol for RNA extraction. For cDNA synthesis, 100 ng of total RNA from each sample was reverse transcribed using the Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). The reverse transcription reaction was carried out according to the manufacturer’s instructions to ensure efficient synthesis of complementary DNA. Gene expression levels were quantified using the 2−ΔCt method, with Gapdh as the internal reference gene for normalization. Specific primers for the target genes were used. The relative expression of target genes was calculated by 2−ΔΔCt method. Data analysis was performed using QuantStudio Design & Analysis Software (Thermo Fisher Scientific, USA).

Immunofluorescence staining

Cells were fixed in 4% paraformaldehyde (PFA) for 15 min at RT, followed by permeabilization with 0.3% Triton X-100 for 10 min. Blocking was performed with 5% Chemiblocker for 1 h at RT to minimize non-specific binding. For choroidal vascular cells, primary antibodies were used against Endomucin (1:200, Cat. 4052388, Millipore, USA), and TPC2 (1:250, Cat. Ab119915, Abcam, USA). For retinal microglia, primary antibodies included CHIL3 (1:1000, Cat. PA5-81356, Invitrogen, USA), CD11b (1:500, Cat. B261558, BioLegend, USA), and TPC2. Primary antibody incubation was carried out overnight at 4 °C. Following primary antibody incubation, cells were incubated with secondary antibodies Alexa Fluor 488/647 (1:800, Cat. A-21121/A-21247, Invitrogen, USA) for 1 h at RT in the dark. Nuclei were counterstained with DAPI (1:1000) to visualize the cell nuclei. After staining, coverslips were mounted onto slides using an antifade medium to preserve fluorescence. Images were captured using Leica SP8 confocal microscope (Leica Microsystems, Germany).

Western blot

Proteins from cell pellets and supernatant were extracted and quantified as described in MS preparation section. Equal amount of protein was separated by SDS-PAGE on a 10% polyacrylamide gel and transferred to PVDF membranes at 100 V for 1 h at 4 °C. Membranes were blocked with 5% non-fat milk in Tris-buffered saline with Tween 20 (TBST) for 1 h at RT, then incubated overnight at 4 °C with primary antibodies, including anti-CHIL3 (1:1000, Cat. PA5-81356, Invitrogen, USA). After 3 times of washing with TBST, membranes were incubated with HRP-conjugated anti-Rabbit IgG secondary antibodies (1:2000, Cat. 7074, CST, USA) for 1 h at RT. After 3 times of washing, signals were developed using ECL reagents (Bio-Rad, USA). Chemiluminescence was captured using an imaging system (Fusion Solo S, Vilber Lourmat).

Cathepsin D activity assay

Choroid/RPE tissue, supernatant from choroidal sprouting assays, from primary choroidal vascular cell cultures and from iEC were processed for Cathepsin D (CTSD) activity measurement. For supernatant samples, cells or explants were washed twice with PBS and then cultured in serum-free medium for 24 h before media collection to eliminate interference from serum proteases. Supernatants were cleared of debris by sequential centrifugation at 400×g for 5 min and 2000×g for 10 min at 4 °C. Tissue samples were homogenized in ice-cold assay buffer and cleared by centrifugation (10,000×g, 10 min, 4 °C). All cleared supernatants and tissue lysates were aliquoted and stored at − 80 °C until assay. Total protein concentration was determined by BCA assay. CTSD enzymatic activity was measured using a commercial CTSD activity kit (Cat. AB65302, Abcam, USA) according to the manufacturer’s protocol. CTSD activity was normalized to total protein content determined by BCA assay.

Cell signaling pathway analysis in choroidal vascular cells

WT and Tpc2−/− choroidal vascular cells were cultured in serum-free basal medium (EBM-2) for 24 h to synchronize the cells. Following serum starvation, cells were treated with 50 ng/mL VEGF (450-32-10UG, PeproTech, USA), with or without 200 ng/mL CHIL3(Cat. HY-P7845, MCE, USA), for various time points (0, 5, 15, 30, 60 min) to assess the VEGF and CHIL3-modulated signaling. After treatment, cells were lysed in RIPA lysis buffer with protease and phosphatase inhibitor cocktail. Protein concentrations were measured using a BCA assay. The Western blot was conducted as previously described. The membranes were incubated overnight at 4 °C with primary antibodies targeting phospho-NF-κB p65 (1:1000, Cat. 3303 T, CST, USA), NF-κB p65 (1:1000, Cat. 8242 T, CST, USA), phospho-P38 MAPK (1:1000, Cat. 9211, CST, USA), P38 MAPK (1:1000, Cat. 9212, CST, USA), phospho-ERK1/2 (1:1000, Cat. 9106, CST, USA), ERK1/2 (1:1000, Cat. 9102, CST, USA). After washing, membranes were incubated with HRP-conjugated secondary antibodies (1:2000, Cat.7074/7076, CST, USA) for 1 h at RT. Protein expression levels of phosphorylated and total NF-κB, P38 MAPK, and ERK1/2 were quantified using densitometry with Image Lab software (Bio-Rad Laboratories).

Validation of sgRNA targeting murine Tpc2

Plasmids encoding sgRNAs targeting the murine Tpc2 coding region were designed using CHOPCHOP and synthesized. The sequences used were sgTpc2-1: ACCGATTGCCGCACTCAGGA and sgTpc2-3: TGGCCTGACCGAGACGATCG. Plasmids were introduced into HEK-msTPC2-GFP cells [18], and genome editing was validated by Sanger sequencing of PCR-amplified target loci. Indel formation efficiencies were quantified using Tracking of Indels by DEcomposition (TIDE) analysis, and cleavage at the expected sites was further confirmed by T7 endonuclease I (T7EI) assay and flow cytometry.

Nucleofection of primary choroidal vascular cells

CRISPR-Cas9 plasmids were delivered into mouse primary choroidal vascular cells using the 4D-Nucleofector™ System (Lonza) with the Primary Cell 4D-Nucleofector™ X Kit (Cat. No. V4XP-2032) following the manufacturer’s instructions. Briefly, 1–2 × 10⁶ cells were resuspended in Nucleofector™ Solution and mixed with 2 µg endotoxin-free plasmid DNA (sgRNA: Cas9 = 1:1). The mixture was transferred to a nucleocuvette strip and subjected to electrical pulse (program CA-167). Cells were immediately cultured in pre-warmed medium on coated plates at 37 °C with 5% CO₂.

AAV-mediated CRISPR–Cas9 gene targeting in retinal microgliaAAV production

A dual AAV system was used to deliver CRISPR–Cas9 components targeting Tpc2, as previously described [24]. A modified AAV1 capsid carrying the “GL” peptide insertion described in Pavlou et al. [25] was used. Briefly, HEK293T cells were cultured in DMEM supplemented with 10% FBS and transfected at ~ 70–80% confluency using a standard triple-plasmid transfection protocol using polyethyleneimine (PEI). At 72 h post-transfection, cells and culture supernatants were harvested and subjected to three freeze–thaw cycles to release viral particles. Crude lysates were clarified by centrifugation, and AAV particles were purified by iodixanol step-gradient ultracentrifugation. Viral fractions were collected, buffer-exchanged into PBS, and concentrated using centrifugal filter units. Viral genome titers were determined by quantitative PCR and stored at − 80 °C until use.

AAV transduction in retinal microglia

For in vitro transduction, primary retinal microglia were incubated with dual AAVs (sgRNA: Cas9 = 1:1) at the total viral genome of 2.5 × 1010 in microglia medium. Cells were maintained for an additional 7 days to allow for CRISPR-mediated gene editing.

Generation of TPC2 KO iPSC and differentiation to endothelial cellsCulture and maintenance of iPSC

The induced pluripotent stem cell line B7-TetOn-ETV2.2, kindly provided by Prof. Dr. Volker Buskamp (Bonn, Germany) based on an iPSC clone described in C. S. Cowan et al. [26], was used in all experiments and is hereinafter referred to as iPSCs. Cells were cultured on Matrigel-coated 6-well plates in mTeSR™ Plus medium (STEMCELL Technologies, Canada). The medium was changed every two days by fully aspirating the old medium and adding 1 mL of fresh medium. Cells were maintained at 37 °C, 5% CO2. Once achieved 70–80% of confluency, cells were washed with Dulbecco’s balanced salt solution (D-PBS, Gibco, USA) and detached using ReLeSR™ (STEMCELL Technologies, Canada). For efficient detachment, 1 mL ReLeSR was added, incubated for 50 s, aspirated, and then incubated for another 4 min. After incubation, 0.5 mL fresh mTeSR™ Plus medium was added to the cells to detach them. This step was repeated with another 0.5 mL of mTeSR™ Plus medium. Cells were split at a 1:5 ratio and transferred to a Matrigel-coated 6-well plate containing 1 mL of fresh mTeSR™ Plus medium. After splitting, the medium was changed 24 h later.

TPC2 Knockout (KO) in iPSC

Two guide RNAs (sgRNA-top and sgRNA-btm) targeting distinct sites within the human TPC2 coding region were designed (CHOPCHOP) and synthesized (sequences: sgRNA-top: CCATTTCCGGCAGCGACCAG, sgRNA-btm: ACTGGACAGAGTCCGCACAT) (Integrated DNA Technologies, USA). Alt-RTM CRISPR-Cas9 Trans-Activating crRNA ATTOTM 550 (tracrRNA, Integrated DNA Technologies, USA) was complexed with the two sgRNAs to form ribonucleoprotein (RNP) complexes following the manufacturer’s instructions (sgRNA: Cas9 molar ratio typically 2:1). RNPs were introduced into iPSCs by nucleofection using Amaxa 4D Nucleofector (Lonza, Switzerland) with P3-nucleofection solution optimized for human iPSCs (program CB-150). Cells were recovered in pre-warmed mTeSR1 supplemented with 10 µM ROCK inhibitor for 24 h and then expanded.

Single-cell clones were obtained by FACS cell sorting and screened by PCR across the targeted locus. Candidate clones showing altered amplicon size were subjected to Sanger sequencing to confirm the intended fragment deletion. Protein-level validation was performed by Western blot using anti-TPC2 antibody, with β-actin as loading control. A validated clone (clone 1B3) lacking detectable TPC2 protein was selected for downstream differentiation.

iPSC differentiation into iEC

iPSCs (WT and TPC2−/−) were differentiated toward the endothelial lineage using a stepwise protocol from Luo et al. [27]. For Stage 1 (mesodermal progenitor differentiation), cells were cultured in 2 mL basal medium supplemented with 6 µM CHIR99021 (Sigma Aldrich, USA); the basal medium consisted of Gibco™ Advanced DMEM/F12 Medium (Thermo Fisher Scientific, USA), 1× GlutaMAX™ Supplement (Thermo Fisher Scientific, USA), 60 µg/mL L-Ascorbic acid phosphate, and 0.4× P/S. Medium was refreshed after 24 h, and mesodermal progenitor cells were obtained after another 24 h. For Stage 2 (endothelial specification), mesodermal progenitor cells were detached with 0.5 mL Trypsin-EDTA, neutralized, and seeded onto Matrigel-coated dishes in S2 medium, consisting of the same basal medium supplemented with 0.5 µg/mL doxycycline hyclate, 10 ng/mL hEGF (Cat. AF-100-15-100UG, PeproTech, USA), 50 ng/mL hFGF-2 (Cat. AF-100-18B-50UG, PeproTech, USA), and 50 ng/mL VEGF (Cat. 100-20-50UG, PeproTech, USA). Medium was refreshed after 24 h, and iECs were obtained after another 24 h. From day 5 onward, cells were maintained in EGM-2 medium. Endothelial identity was confirmed by immunostaining for vWF (1:200, Cat. sc-53466, SantaCruz Biotechnology, USA) and VE-cadherin (1:200, Cat. sc-9989, SantaCruz Biotechnology, USA). Functional loss of TPC2 in KO iECs was confirmed by lysosomal patch-clamp recording showing absence of TPC2-mediated currents followed the process described by Chen et al. [28].

Statistical analysis

Data are presented as mean ± standard error of the mean (SEM). Student’s t-test was used to compare two different groups. Additionally, a one-way analysis of variance (ANOVA) was conducted, followed by post hoc Dunnett’s tests for multiple comparisons. Two-way ANOVA was used for analyses involving two independent variables, followed by Tukey’s multiple comparisons test. A p-value < 0.05 was considered statistically significant. The graphs were generated by Prism 10.0 and figures with Affinity designer 2.

Comments (0)

No login
gif