Theranostics 2021; 11(1):268-291. doi:10.7150/thno.47021
Research Paper
Zhaofu Liao1*, Yilin Chen2,3,4,5*, Chuncui Duan2,3,4,5, Kuikui Zhu2,3,4,5, Ruijin Huang6, Hui Zhao7, Maik Hintze6,8, Qin Pu6, Ziqiang Yuan9, Luocheng Lv2,3,4,5, Hongyi Chen2,3,4,5, Binglin Lai2,3,4,5, Shanshan Feng2,3,4,5, Xufeng Qi2,3,4,5
, Dongqing Cai2,3,4,5 ![]()
1. The First Affiliated Hospital, Key Laboratory of Regenerative Medicine, Ministry of Education, Jinan University, Guangzhou 510632, China.
2. Key Laboratory of Regenerative Medicine, Ministry of Education, Jinan University, Guangzhou 510632, China.
3. Joint Laboratory for Regenerative Medicine, Chinese University of Hong Kong-Jinan University, Guangzhou 510632, China.
4. International Base of Collaboration for Science and Technology (JNU), Ministry of Science and Technology, Guangdong Province, Guangzhou 510632, China.
5. Department of Developmental and Regenerative Biology, Jinan University, Guangzhou 510632, China.
6. Institute of Anatomy, Department of Neuroanatomy, University of Bonn, Germany.
7. Stem Cell and Regeneration TRP, School of Biomedical Sciences, Chinese University of Hong Kong, Hong Kong.
8. Medical Department, MSH Medical School Hamburg, Germany.
9. Cancer Institute of New Jersey, Department of Medical Oncology, Robert Wood Johnson of Medical School, USA.
*Equal contributions to this work.
This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions.
Citation:
Promotion of cardiac angiogenesis in ischemic myocardium is a critical strategy for repairing and regenerating the myocardium after myocardial infarction (MI). Currently, effective methods to aid in the survival of endothelial cells, to avoid apoptosis in ischemic myocardium and to achieve long-term cardiac angiogenesis are still being pursued. Here, we investigated whether cardiac telocyte (CT)-endothelial cell communication suppresses apoptosis and promotes the survival of endothelial cells to facilitate cardiac angiogenesis during MI.
Methods: CT exosomes were isolated from CT conditioned medium, and their miRNA profile was characterized by small RNA sequencing. A rat model of left anterior descending coronary artery ligation (LAD)-mediated MI was assessed with histology for infarct size and fibrosis, immunostaining for angiogenesis and cell apoptosis and echocardiography to evaluate the therapeutic effects. Cardiac microvascular endothelial cells (CMECs) and the LAD-MI model treated with CT exosomes or CT exosomal miRNA-21-5p in vitro and in vivo were assessed with cellular and molecular techniques to demonstrate the underlying mechanism.
Results: CTs exert therapeutic effects on MI via the potent paracrine effects of CT exosomes to facilitate the inhibition of apoptosis and survival of CMECs and promote cardiac angiogenesis. A novel mechanism of CTs is revealed, in which CT-endothelial cell communication suppresses apoptosis and promotes the survival of endothelial cells in the pathophysiological myocardium. CT exosomal miRNA-21-5p targeted and silenced the cell death inducing p53 target 1 (Cdip1) gene and thus down-regulated the activated caspase-3, which then inhibited the apoptosis of recipient endothelial cells under ischemic and hypoxic conditions, facilitating angiogenesis and regeneration following MI.
Conclusions: The present study is the first to show that CTs inhibit cardiac microvascular endothelial cell apoptosis through exosomal miRNA-21-5p-targeted Cdip1 silencing to improve angiogenesis in myocardial infarction. It is believed that these novel findings and the discovery of cellular and molecular mechanisms will provide new opportunities to tailor novel cardiac cell therapies and cell-free therapies for the functional and structural regeneration of the injured myocardium.
Keywords: cardiac telocytes, apoptosis of endothelial cells, regeneration of myocardial infarction, exosomal miR-21, Cdip1 gene
Regeneration of myocardial infarction (MI), a major cause of morbidity and mortality worldwide, remains a substantial clinical challenge. Effective strategies to promote survival and avoid apoptosis of endothelial cells in the ischemic myocardium could help to achieve long-term cardiac angiogenesis. In the hostile ischemic microenvironment during MI, most cardiac cells, including cardiomyocytes, endothelial cells and macrophages, were shown to undergo apoptosis [1, 2]. In a nonhuman primate model of MI and heart failure (HF), except for cardiomyocyte apoptosis, nonmyocyte apoptosis was shown to account for the majority of apoptotic cells in both adjacent and remote areas, while macrophages comprised the largest fraction of apoptotic nonmyocytes (41% vs. 18% neutrophils, 25% endothelial and other cells, and 16% fibroblast-like cells) [1]. Indeed, the unexpectedly high level of nonmyocyte apoptosis was confirmed in myocardial biopsies from patients with congestive cardiomyopathy and HF [1], while apoptotic endothelial cells, interstitial cells and fibroblast-like cells, but rarely apoptotic myocytes, were detected in the right ventricle of a murine model of right ventricular volume overload [3]. These findings suggest that endothelial cells, such as cardiac microvascular endothelial cells (CMECs), comprise up to one-third of the total heart cells and play a critical role in maintaining and supporting coronary microvessels and adjacent cardiomyocytes under normal conditions and angiogenesis under pathophysiological conditions. Apoptosis induced by ischemic injury is an important pathophysiological event in MI and MI regeneration. Indeed, it has been revealed that endothelial cells are more prone to incur damage than cardiomyocytes during ischemia and reperfusion injury [4-6], while apoptosis of CMECs as well as other endothelial cell beds induced by ischemia and hypoxia injury precedes cardiomyocyte apoptosis and the release of soluble proapoptotic mediators from endothelial cells in an ischemic environment and can promote cardiomyocyte apoptosis [7]. These findings suggest that protecting endothelial cells, especially CMECs, from apoptosis under MI will be one method of promoting cardiac angiogenesis and achieving more effective regeneration of MI. Accordingly, effective strategies for repressing CMEC apoptosis have recently been pursued to develop more effective means to regenerate MI and prevent post-MI heart failure.
Recent progress in the field has revealed that cells (cardiomyocytes and noncardiomyocytes, such as endothelial cells and other interstitial cell types) within the supporting niche of the myocardium play an important role in supporting cardiac physiopathology and myocardial regeneration [8]. A novel population of cardiac interstitial cells named telocytes has recently been identified in the heart interstitium [9-18]. Recently, we demonstrated that following permanent coronary occlusion, a significant number of CTs in the infarct zone undergo cell death, and the CT network in the ischemic area is destroyed. The therapeutic transplantation of CTs in rats with acute MI has been shown to decrease infarct size and improve myocardial function in the short term (2 weeks) and mid-term (14 weeks) by promoting cardiac angiogenesis and reconstruction of the CT network and decreasing cardiac fibrosis [19, 20]. Accordingly, in this study, we further hypothesize that CTs might play an important role in the endogenous angiogenic potential in the myocardium, and one mechanism underlying CT-mediated cardiac angiogenesis for MI after CT transplantation might be CT-derived exosomes (CT-exos), which repress apoptosis via CT-CMEC communication. Indeed, we report here for the first time that CTs induce antiapoptotic effects for CMECs via CT exosomal miRNA-21-5p-targeted Cdip1 silencing to inhibit caspase-3 activation and thus improve angiogenesis and regeneration following MI.
AnimalsThree-month-old female Sprague-Dawley (SD) rats (250-300 g) were utilized in the present study. The rats were housed for 2 weeks to allow them to adapt before experimentation. They were provided with food and water ad libitum. Animal care, surgery and handling procedures were performed according to regulations established by The Ministry of Science and Technology of the People's Republic of China ([2006] 398) and approved by Jinan University Animal Care Committee.
Isolation and phenotypic confirmation of cardiac telocytesYoung (3-month-old) female SD rats were used to isolate CTs using a previously described method [19, 20]. Briefly, the hearts were isolated and minced, and then, the tissues were treated with 2.5 mL of DMEM supplemented with 0.05% collagenase P (cat. no. 11213865001; Roche) and 0.1% trypsin (cat. no. 0458; Amresco) and incubated for 10 min at 37 °C on a shaker (180 rpm). After the supernatant was removed, collagenase and trypsin medium were added, and the mixture was incubated at 37 °C on a shaker for 45 min. The digested tissue was dissociated by gentle pipetting every 15 min. The supernatant was then sequentially filtered through a 100-µm and a 41-µm nylon mesh, and the collected cell suspension was centrifuged at 50 × g for 2 min. The supernatant was then removed and recentrifuged at 300 × g for 10 min. The pellet was resuspended in 5 mL of PEB medium (PBS supplemented with 0.5% bovine serum albumin and 2 mM EDTA [pH 7.2]). The mixture was then centrifuged at 38 × g for 2 min to remove the debris, and the collected supernatant was further centrifuged at 200 × g for 10 min. The cell pellet was then mixed with 1 mL of PEB and 5 µL of a rabbit anti-rat C-kit antibody (1:50; cat. no. PA5-16770; Thermo Fisher), and the sample was incubated at 4 °C for 40 min. An additional 2 mL of PEB was then added, and the mixture was centrifuged at 458 × g for 4 min to collect the cells. The pellet was resuspended in 160 µL of PEB, and 20 µL of a solution containing goat anti-rabbit IgG microbeads (cat. no. 5111007039; Miltenyi Biotec) was added, followed by incubation at 4 °C for 25 min. The mixture was then added to a magnetic separation (MS) column (Miltenyi Biotec) in a magnetic field, and the unlabeled cells were allowed to pass through. The MS column was then removed from the magnetic field, and the labeled cells were flushed out with PEB. The isolated cell pellet was collected by centrifugation at 458 × g for 4 min, followed by culture in DMEM containing 20% fetal calf serum at 37 °C and 5% CO2 in a 95% air incubator. With this method, more than 93% of the isolated cells were C-kit+ and CD34+ [19, 20]. In this study, only isolated CTs at passage 5 or less were used for the experiments.
For phenotypic confirmation, the isolated cells collected by the above protocol were seeded in lysine-treated coverslips and cultured with DMEM containing 20% fetal calf serum at 37 °C and 5% CO2 in a 95% air incubator. As the unique morphology is a critical standard for identification of the CTs, the cultured cells were assessed by microscopy in the earliest passage (Passage-0) 2 days after seeding. It was found that most of the cells had piriform/spindle/triangular cell bodies containing long and slender telopods with the alternation of thick segments (podoms) and thin segments (podomers) (Figure S1A). At present, there is no unique marker for distinguishing CTs by the expression of a single protein, and the most commonly used markers are c-kit, CD34, vimentin and PDGFRA [21-26]. Therefore, double immunofluorescence staining, which was conducted with anti-c-Kit+anti-CD34 (1:50; cat. no. PA5-16770; Thermo Fisher vs. 1:50; cat. no. AF4117; R&D) and anti-c-Kit+anti-vimentin (1:50; cat. no. PA5-16770; Thermo Fisher vs. 1:100; cat. no. ab8978; Abcam) for the collected Passage-0 cells was applied. The collected cells were positive for c-Kit, CD34 and vimentin (low expression) (Figure S1B a1-4 and Figure S1C b1-4) and showed commonly used telocyte markers. As it was reported that c-Kit+ and/or CD34+ endothelial cells were found in the myocardium [18, 27], to exclude the possibility that the c-Kit+ endothelial cells were mixed with the collected CTs during sorting, we performed double immunofluorescence staining with different combinations (anti-c-Kit+anti-CD31 [1:50; cat. no. sc-365504; Santa Cruz vs. 1:100; cat. no. 11265-1; Proteintech], anti-c-Kit+vWF [1:50; cat. no. sc-365504; Santa Cruz vs. 1:100; cat. no. F3520; Sigma]) for the collected Passage-0 cells. The collected cells were negative for CD31 and vWF, well-established markers of endothelial cells (Figure S1B c1-4 and d1-4). Considering that c-Kit and CD34 are also recognized as markers for hematopoietic lineage stem cells or progenitor stem cells [21], we observed the potential characteristics of stem cells in the collected CTs by colony formation and successive passage assays for proliferation potential as well as mesoderm differentiation assays. The results indicated that the potency of colony formation and proliferation of the collected CTs did not meet the standards for stem cells, as we found that the cultured CTs did not show colony formation (Figure S1C) and entered growth arrest in approximately 10-15 passages when they were serially subcultured (data not shown). Furthermore, the results of the differentiation assay showed that the collected cells (passages 1~2) failed to be induced to differentiate into mesoderm-derived cells, such as bone and fat cells (Figure S1D). The bone cell differentiation protocol was as follows: DMEM included 10% FBS, dexamethasone (1 µM), ascorbic acid (50 µg/mL), β-glycerophosphate (10 mM), and 1-α,25-dihydroxyvitamin D (10 nM), the cells were treated for 16 days at 37 °C and 5% CO2 in a 95% air incubator, and osteogenic differentiation was identified by Alizarin red S staining. The fat cell differentiation protocol was as follows: DMEM included 10% FBS, dexamethasone (1 μM), 3-isobutyl-1-methylxanthine (0.5 mM) and insulin (5 µg/mL), the cells were treated for 16 days at 37 °C and 5% CO2 in a 95% air incubator, and fat cell differentiation was identified by oil red O staining. In addition, the individual isolated cells, which possess the hallmark morphology of telocytes in its Passage-0 stage, as shown in Figure S1A, were collected using a micromanipulator under microscopy. Single-cell RNA sequencing was applied for gene expression profile analysis (detailed method not shown here). Our preliminary results for 11 collected single cells revealed that all 11 cells were negative for the common stem cell markers Oct-4, SSEA-1 and Sca-1. In addition, the cells were positive for CD105, CD73 and Col1a1 (Figure S1E), which are commonly expressed by mesenchymal linage-derived interstitial cells. The positive expression of single-cell sequencing was set at ≥ 10 FPKM. All of the above evidence strongly indicates that the CTs applied in this study are consistent with the commonly accepted morphology and molecular marker features of telocytes [21-26]. These cells are more similar to interstitial cells than endothelial cells and progenitor stem cells, as they are negative for CD31 and vWF, and the progenitor or stem cell characteristics are not notable, although the cells were positive for c-Kit and CD34.
Isolation of CMECs from adult rat heartsYoung (3-month-old) female Sprague-Dawley rats were used. The hearts were removed, and CMECs were isolated and cultured in CMEC medium (medium 199 basic supplemented with 10% fetal bovine serum, 100 U/mL penicillin, 100 μg/mL streptomycin and endothelial cell growth supplement) as described in our previous report [28, 29].
Media conditioning and exosome purificationCT cells were grown in 100-mm dishes at 37 °C in 5% CO2 and 95% air, in DMEM containing 1% penicillin, streptomycin and 20% FBS until they reached 80-90% confluence, and then, the culture medium was removed. After three washes with PBS (pH 7.4), DMEM containing 20% exosome-free serum was added, and the cells were incubated at 37 °C in 5% CO2 and 95% air for 48 h. Ten milliliters of conditioned medium was harvested from different dishes and centrifuged at 3000 × g for 15 min to pellet the cells before filtering through a 0.22-µm filter to remove cell debris. The collected medium was used to extract CT-derived exosomes (CT-exos) with ExoQuick-TC Exosome Precipitation Solution (cat. no. EXOTC50A-1; SBI) according to the manufacturer's instructions. Briefly, 2 mL of ExoQuick-TC Exosome Precipitation Solution was mixed with the collected medium, incubated at 4 °C overnight, and then centrifuged at 1500 × g for 30 min. After the supernatant was removed, the pellet was recentrifuged at 1500 × g for 5 min to remove the residual fluid, and then, the CT-exos were resuspended in PBS (pH 7.4).
For generation of miR-21-5p-deficient exosomes (CT-exos-miR21KO) or miR-21-5p-overexpressing exosomes (CT-exos-miR21OE), CTs were transfected in suspension with antagomir miR-21-5p inhibitor (5'-UCAACAUCAGUCUGAUAAGCUA-3'; 100 nM; GenePharma) or agomir miR-21-5p mimic (5'-UAGCUUAUCAGACUGAUGUUGA-3'; 100 nM; GenePharma) and seeded onto 100-mm dishes. Exosomes were isolated from DMEM containing 20% exosome-free serum conditioned media (48 h conditioning) as described in the protocol above.
Transmission electron microscopy for CTs and CT exosomesTissue samples of the left ventricular myocardium of female SD rats were obtained and processed for transmission electron microscopy (TEM) to observe the unique morphology of CTs. Briefly, tissue specimens (approximately 1 mm3) were fixed with 4% glutaraldehyde (in 0.1 M cacodylate buffer, pH 7.3) for 24 h at 4 °C. After a brief wash in 0.1 M cacodylate buffer (CB), the tissue samples were postfixed with 1% osmium tetroxide in 0.1 M CB for 1 h at 4 °C, followed by dehydration in a graded series of ethanol solutions. After impregnation with propylene oxide, the samples were immersed overnight in a mixture of propylene oxide and Epon, followed by embedding in Epon. Ultrathin sections were cut and collected on formvar-coated copper grids, stained with uranyl acetate and lead citrate, and observed using TEM (Philips Tecnai 10 TEM).
Three microliters of isolated CT-exos was placed on formvar carbon-coated 200-mesh copper electron microscopy grids, incubated at room temperature for 5 min, and then subjected to standard uranyl acetate staining. The grid was washed with PBS three times and allowed to become semidry at room temperature before observation. The morphology and diameter of the CT-exos were analyzed using TEM (Philips Tecnai 10 TEM).
Scanning electron microscopy for CT exosomesThe isolated CT-exos suspended in PBS were adhered to Formvar-coated copper grids. The preparations were attached to metal stubs and coated with gold to a thickness of 15 nm. The morphology and diameter of the CT-exos were analyzed using a Philips XL30 scanning electron microscope (SEM).
Atomic force microscopy for CT exosomesFor atomic force microscopy (AFM) analysis, the isolated CT-exos were diluted 1:100 in deionized water and adsorbed to freshly cleaved mica sheets for 10 min. The sheets were rinsed thoroughly with deionized water to remove unbound CT-exos and dried under a gentle stream of nitrogen. Bioscope II (Veeco Digital Instruments, Santa Barbara, CA) was used for tapping mode AFM imaging using silicon probes with spring constant k = 305 kHz (OTESPA, Veeco). Topographic height and phase images were recorded simultaneously at 5126512 pixels at a scan rate of 0.4 Hz.
Nanoparticle tracking analysis (NTA) for CT exosomesAnalysis of the absolute size distribution of the CT exosomes was performed using NanoSight NS300 (Malvern, UK). The light scattered by the exosomes with laser illumination was captured by a camera, and a video file of exosomes moving under Brownian motion was created. The NTA software tracked and analyzed particles individually from 10 to 1000 nm. Three recordings were performed for each sample.
Isolation of total RNA from CT exosomesTotal RNA from CT-exos was extracted using a Total Exosome RNA and Protein Isolation Kit (cat. no. 4478545; Invitrogen). The freshly prepared CT-exos pellets were dissolved in 200 µL of exosome-resuspension buffer and loaded onto RNA columns according to the manufacturer's protocol. The RNA was finally eluted with 50 µL of RNase-free water. The quantity and quality of the RNA were determined using an Agilent 2200 TapeStation System High Sensitivity R6K Reagent (Agilent Technologies).
Small RNA sequencingSmall RNAs were sequenced by the RiboBio Company (Guangzhou, China). Total RNA (10 µg) from the CT-exos was used to construct a library with the TruSeq® Small RNA Sample Prep Kit (Illumina, USA). Briefly, small RNAs (sRNAs) were recovered from a portion of the denaturing polyacrylamide gel corresponding to a size of approximately 18-30 nucleotides. The collected sRNAs were ligated with adapters at both ends. Subsequently, the adapter-ligated sRNAs were amplified by RT-PCR using low-cycle amplification. The PCR products were purified on a 12% polyacrylamide gel and the collected products were then sequenced using a HiSeqTM 2500 instrument (Illumina, San Diego, CA, USA).
Identification and quantification of miRNAs included in CT exosomesThe fifty-one-nucleotide raw reads obtained from sequencing were processed by removing poor quality reads, reads without a 3' adapter, 5' adapter- contaminated reads, reads without an insert fragment, reads containing poly (A) stretches, and reads shorter than 18 nt to acquire clean reads and generate the miRNA expression profile. The 18- to 30-nt modified sequences were mapped onto rat genome 5 using the Burrows-Wheeler Alignment Tool (BWA) and the default parameters. The clean reads were compared with small RNA databases (miRNA from miRBase20.0; rRNAs, tRNAs, snRNAs and snoRNA from Rfam11.0; piRNA from piRNAbank) to annotate the sRNA sequences. The clean reads with fewer than 10 copies were removed from the list. Only sRNAs whose precursor and mature sequences perfectly matched known rat miRNAs in the miRBase were considered conserved miRNAs. The expression level of miRNAs in the CT-exos was normalized using the following formula: transcripts per million (normalized expression (NE) = actual miRNA count/total clean read count ×1,000,000).
Analysis of CT exosome uptake in CMECsThe conditioned medium from CTs (including secreted CT-exos; 10 mL) was collected as described above and then mixed with DiI (1,1'-dioctadecyl-3,3,3'3'-tetramethylindocarbocyanine perchlorate; 10 µM final concentration; cat. no. 60010; Biotium) for 15 min at room temperature, followed by dialysis for 24 h with 3 changes of 500 ml of PBS (pH 7.4) using dialysis tubing with a 2 kDa cutoff. After dialysis, the DiI-stained CT-exos were extracted with an ExoQuickTM precipitation solution (cat. no. EXOTC50A-1; SBI). The collected exosomes were resuspended in 100 µL of PBS (pH 7.4). The isolated rat CMECs were prepared as described above, incubated with DiI-stained CT-exos (5 µL) for 6 h, and then incubated with LysoTracker (cat. no. L7526; Invitrogen) for 2 h in CMEC culture medium at 37 °C in a 5% CO2 and 95% air incubator. After staining with Hoechst 33342, the CT-exos-treated CMECs were imaged with a confocal microscope (FV3000, Olympus) using a 60 × oil-immersion objective.
Transwell coculture assay for exosomes secreted by CTsFor the CT exosome transfer assay, transwell cocultures of CTs (upper chamber) and CMECs (lower chamber) were conducted using transwells with 0.4-μm-pore polyethylene terephthalate (PET) membranes (cat. no. PIHT30R48; Millipore), which allow exosomes to pass through but do not allow direct cell-to-cell contact between the upper and lower wells. CMECs (2×105) were seeded in the lower chamber and cultured in CMEC culture medium at 37 °C in a 5% CO2 and 95% air incubator overnight. Then, the medium was replaced with medium 199 basic supplemented with 10% exosome-free fetal bovine serum. CTs (2×105 cells) transfected with 100 nM miR-21-5p-FAM agomir for 6 h or stained with calcein-AM dye (cat. no. 40719ES50; Yeasen) for 30 min with extensive washing or staining with DiI dye (cat. no. 60010; Biotium) for 30 min with extensive washing were added to the upper chamber and cocultured for 48 h. The treated CMECs were imaged under microscopy (FV3000, Olympus) or washed with PBS (pH = 7.4) and then collected with 0.25% trypsin for fluorescence assessment using a flow cytometer (Cytoflex; Beckman Coulter). The CT-free cells in the upper chamber were used as a blank control.
For the CT endogenous exosomal miRNA-21-5p knockdown assay, similarly, transwell cocultures of CTs and CMECs were used. CMECs (2×105) were seeded in the lower chamber and cultured in CMEC culture medium at 37 °C in a 5% CO2 and 95% air incubator overnight. Then, the medium was replaced with medium 199 basic supplemented with 10% exosome-free fetal bovine serum. CTs or CTs transfected with miR-21-5p antagomir (CTs-miR21KO) were seeded in the upper chamber for 72 h of coculture. The treated CMECs were collected to extract total RNA. The expression of miR-21-5p in cocultured CMECs was detected using real-time quantitative-PCR (qPCR). The CTs-free cells in the upper chamber were used as a blank control.
CT exosome treatment of CMECsFor CT-exos treatment analysis, CMECs were cultured at a density of 5×104 cells/mL and allowed to attach and grow overnight. The next day, they were treated with 300 μg/mL CT-exos or CT-exos-miR21KO for 24 h. A group treated with PBS in parallel was used as a control. The treated CMECs were used for q-PCR, cell viability assays, migration assays, tube formation assays, apoptosis assays and western blot assays.
Cell viability assayCell viability was measured using the CCK-8 assay kit (cat. no. CK04; Dojindo) according to the manufacturer's instructions. Briefly, 10 µL of CCK-8 solution was added to each well (100 µL of medium) and incubated for 1 h at 37 °C in a 5% CO2 and 95% air incubator, and the absorbance was then measured at 450 nm in a microplate reader (Biotek). CMECs were cultured in CMEC culture medium at 37 °C in a 5% CO2 and 95% air incubator set as normoxia, while CMECs were cultured in serum-free medium 199 basic at 37 °C in a 5% CO2, 94% N2 and 1% O2 incubator set as ischemia-hypoxia. For analysis of the CT-exos effect, the CT-exos-, CT-exos-miR21KO- and PBS-treated groups were observed, while for analysis of the miR-21-5p effect, the miR-21-5p, scramble, CT-exos and blank groups were investigated. In addition, for analysis of the siCdip1 effect, the siCdip1, scramble and blank groups were observed.
Migration assayFor the wound healing migration assay, CMECs were cultured on 24-well plates at a density of 1×105 cells per well. The monolayer CMECs (approximately 80% confluence) were scratched with 1 mL pipette tips and washed with PBS to remove the cell debris. M199 basic supplemented with different types of exosomes (1 mL) or PBS was added to each well. Images were captured using an inverted phase microscope (Olympus IX71, Japan) at 0 h, 12 h and 24 h after the cell layer was wounded. The migration rate (%) was calculated as follows: migration rate (%) = (A0 - An)/A0 × 100%, where A0 represents the initial wound area (t = 0 h) and An represents the residual area at the measuring point (t = n h).
Tube formation assayThe in vitro angiogenesis assay was conducted using Matrigel Basement Membrane Matrix (cat. no. 354234; Corning) according to the manufacturer's instructions. Briefly, the Matrigel was thawed overnight at 4 °C. Then, the Matrigel was added to 48-well plates at 150 µL per well using cold tips on ice and incubated at 37 °C to solidify. Next, CMECs (5×104 cells per well) were resuspended in serum-free medium supplemented with different types of treatments and cultured on solidified Matrigel under normoxic and ischemia-hypoxic conditions. After 8 h of incubation, the cells were photographed using an inverted optical microscope (Olympus IX71, Japan), and the length of the formed tube was calculated using ImageJ 1.22 software (National Institutes of Health, USA). CMECs were cultured in CMEC culture medium at 37 °C in a 5% CO2 and 95% air incubator as the normoxic condition or in serum-free medium 199 basic at 37 °C in a 5% CO2, 94% N2 and 1% O2 incubator as the ischemic-hypoxic condition. For determination of the effect of CT-exos, the CT-exos-, CT-exos-miR21KO- and PBS-treated groups were observed, while for analysis of the miR-21-5p effect, the miR-21-5p, scramble, CT-exos and blank groups were investigated.
Apoptosis assay using flow cytometryCMECs were cultured in CMEC culture medium at 37 °C in a 5% CO2 and 95% air incubator as the normoxic condition or in serum-free medium 199 basic at 37 °C in a 5% CO2, 94% N2 and 1% O2 incubator as the ischemic-hypoxic condition. For analysis of the CT-exos effect, the CT-exos-, CT-exos-miR21KO- and PBS-treated groups were observed, while for analysis of the miR-21-5p effect, the miR-21-5p, scramble, CT-exos and blank groups were investigated. In addition, for analysis of the siCdip1 effect, the siCdip1, scramble and blank groups were observed. An Annexin V/PI kit (FXP023-100, 4A Biotech) and subsequent flow cytometry analysis were applied to investigate the apoptosis of treated CMECs according to the manufacturer's instructions. Briefly, the treated CMECs (5×105) were washed with cold PBS, resuspended in 100 µL of binding buffer and stained with 5 µL of Alexa Fluor 647-conjugated Annexin V. Following a 5-min incubation in a dark room, 10 µL of PI and 400 µL of binding buffer were added. Finally, the cells were analyzed using a flow cytometer (Cytoflex; Beckman Coulter). Early and late apoptotic cells were examined using plots of fluorescence 2 (FL2 for PI) versus fluorescence 1 (FL1 for Annexin V). A total of 10,000 events were collected and analyzed for each sample.
Transfection of rno-miR-21-5p mimics in CMECsThe isolated CMECs were cultured to 80% confluence with complete culture medium as described above at 37 °C in a 5% CO2 and 95% air incubator and then transfected with rno-miR-21-5p mimics (5'-UAGCUUAUCAGACUGAUGUUGA-3'; 100 nM; GenePharma) or the scrambled control (5'-UUCUCCGAACGUGUCACG-3'; 100 nM; GenePharma) using Lipofectamine RNAiMAX (cat. no. 13778150; Invitrogen). The transfected cells were used for qPCR, cell viability assays, migration assays, tube formation assays, apoptosis assays or western blot assays. In the above assays, 3 identical wells were observed in each analysis, and three repeat experiments were conducted.
Prediction of microRNA-targeted genesTargetScan (http://www.targetscan.org/) and miRWalk (http://www.umm.uni-heidelberg.de/apps/zmf/mirwalk/index.html) were used to predict the potential target genes of rno-miR-21-5p. Only genes predicted by both databases were used for the subsequent functional analysis.
Dual luciferase reporter assayLuciferase reporters were constructed by cloning sequences from the 3' untranslated regions (3'UTRs) of the Cdip1 mRNAs into the psiCHECK-2 vector (cat. no. C8021, Promega). Briefly, the wild-type 3' UTR of the Cdip1 gene, which contains the predicted miR-21 response element, as well as mutant 3' UTRs were synthesized and then inserted in the multiple cloning region behind the synthetic Renilla luciferase gene. HEK293 cells were cotransfected with the constructed reporter plasmid (0.05 μg) and rno-miR-21-5p mimics (50 nM) or the scrambled control using Lipofectamine 3000 transfection reagent (cat. no. L3000008, Invitrogen). A reporter assay was performed 48 h after transfection using the Dual Luciferase Reporter Assay System (cat. no. E1910, Promega) according to the manufacturer's protocol. The luciferase signal was normalized to the signal arising from an intra plasmid Renilla/firefly luciferase transfection reporter cassette in HEK293 cells.
Isolation of total RNA and real-time quantitative PCRTotal RNA was extracted using TRIzol reagent (cat. no. 15596018; Invitrogen) according to the manufacturer's protocol. The quantitative analysis of rno-miR-21-5p expression was performed with a Hairpin-it miRNA q-PCR Quantitation Kit (cat. no. E01006-E01015; GenePharma) according to the manufacturer's instructions. First, the extracted RNA (1 μg) was reverse-transcribed using specific stem-loop primers as described in the manual, and then, the expression levels of rno-miR-21-5p were analyzed using SYBR Green-based real-time PCR. The reaction mixture was composed of 10 µL of 2× Real-time PCR buffer, 0.32 µL of miR-21-5p specific primers, 0.2 µL of Taq DNA polymerase, 7.48 µL of PCR-grade water and 2 µL of the cDNA template. Amplifications were performed on a Mini-Opticon System (Bio-Rad) using the following PCR conditions: initial denaturation at 95 °C for 3 min followed by 40 cycles of amplification at 95 °C for 12 s and 62 °C for 40 s. Ct values were averaged and normalized to U6. Relative expression was determined using the 2-ΔΔCt comparative threshold method.
For analysis of the expression of the phosphatase and tensin homolog (Pten), programmed cell death programmed cell death 4 (Pdcd4), and Cdip1 genes, the extracted RNA (1 μg) was reverse-transcribed into first-strand cDNAs using ReverTra Ace q-PCR RT Master Mix with gDNA Remover (cat. no. FSQ-301, Toyobo) according to the manufacturer's instructions, and then, the gene expression levels were analyzed using SYBR Green-based real-time PCR. The reaction mixture was composed of 10 µL of SYBR Green PCR Master Mix (cat. no. B21202; Biotool), 1 µL of each primer, 8 µL of PCR-grade water and 1 µL of the cDNA template. The following primers were used (5'-3'): Pten forward: GGGAAAGGACGGACTGGTGT, reverse: ATAGCGCCTCTGACTGGGAAT; Pdcd4 forward: GAGCACGGAGATACGAACGAA, reverse: GTCCCGCAAAGGTCAGAAAG; and Cdip1 forward: GACTTCAGCCTTTTGTTCATGG, reverse: TCTTTGCTGTTGATACTCCTGG. Amplifications were performed with a Mini-Opticon System using the following conditions: 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 15 s and primer annealing and extension at 62 °C for 30 s. All cDNA samples were amplified in triplicate and normalized to β-actin expression on the same plate. Three replicates of each specimen were examined. The results of this study were generated from three rats.
RNA interferenceThe synthesized si-Cdip1 (siCdip1: 5'-CCUACAUGCCUGCAGGUUUdTdT-3') and scrambled control (as described above) (GenePharma, China) were transfected into CMECs with Lipofectamine RNAiMAX (cat. no. 13778150; Invitrogen), according to the manufacturer's instructions. Briefly, CMECs were cultured for 12 h with CMEC culture medium as described above at 37 °C in a 5% CO2 and 95% air incubator. Lipofectamine RNAiMAX was mixed with siRNA (100 nM) or the scrambled control, added to the cells and incubated at 37 °C for 24 h to silence the RNA. CMECs were incubated with the transfection complex for 48 h, incubated in the ischemia-hypoxia environment for 24 h and then harvested for flow cytometry analysis using the Annexin V/PI assay or western blot analysis.
Western blot analysisThe CT-exos or CMEC lysates were prepared in radioimmunoprecipitation assay (RIPA) buffer (cat. no. P0013C; Beyotime) containing a protease inhibitor cocktail (cat. no. W2200s; Cwbio). The total protein concentration was analyzed using a BCA Protein Assay Kit (cat. no. P0010; Beyotime). The extracted CT-exos or CMEC proteins were denatured in loading buffer (5× SDS-PAGE loading buffer: 0.5 M Tris-HCl, pH 6.8, 0.05% beta-mercaptoethanol, 1% SDS, 0.005% bromophenol blue, 50% glycerol) for 10 min at 95 °C, electrophoresed on a 12% SDS-PAGE gel, and transferred to a PVDF membrane (cat. no. 162-0177; Bio-Rad). After being blocked with 5% nonfat milk in TBST buffer, the PVDF membranes were incubated with the appropriate primary antibodies, including anti-CD63 (1:1000; cat. no. EXOAB-CD63A-1; SBI), anti-Cdip1 (1:1000; cat. no. NBP1-76996; Novus), anti-cleaved Caspase-3 (1:1000; cat. no. 9662S; CST), anti-β-actin (1:20000; cat. no. 66009-1-Ig; Proteintech), and anti-GAPDH (1:20000; cat. no. 60004-1-Ig; Proteintech) overnight, washed with TBST, and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies. The protein bands were visualized and imaged using an enhanced chemiluminescence system on a chemiluminescence reader (GeneGnome HR; Synoptics).
Induction of myocardial infarction and intramyocardial injectionMIs were generated in three-month-old female SD rats as our and others previously described [19, 20, 28, 30-32]. Briefly, the rats were anesthetized with ketamine (100 mg/kg, i.p.) and underwent a left intercostal thoracotomy. The left anterior descending coronary artery (LAD) was identified and then ligated directly below the left atrial appendage with 8-0-gauge nylon sutures. The presence of pallor and abnormal movement of the left ventricle confirmed LAD occlusion. Intramyocardial injections were performed within 30 min after LAD ligation. CTs, CT-exos (300 µg of total protein in 50 µL of PBS [pH 7.4]) and the rno-miR-21-5p agomir (50 µg in 50 µL of RNase-free water; chemically modified and designed for in vivo study) were injected using a 30-gauge needle and a 10-µL Hamilton syringe. Each heart received 5 injections (10 µL/injection), with 3 injections in border areas of the ischemic zone and 2 injections in the center of the ischemic area. Rat models of MI were injected with PBS (pH 7.4; 50 µL) and served as a control for CT or CT-exos treatment. One group injected with scrambled mimics (50 µg in 50 µL of RNase-free water) served as a microRNA control. The chest wall was then closed, the lungs were inflated, the rat was extubated, and the thoracotomy was closed. After recovery, the rats were returned to the animal facility. The groups receiving CTs, CT-exos, PBS and sham were evaluated for cardiac function and anesthetized on day 28, and the groups receiving the miR-21-5p agomir and scrambled control were evaluated for cardiac function and anesthetized on day 7 to collect the treated hearts. The tissues were fixed with 4% paraformaldehyde, embedded in paraffin wax and sectioned. In the present study, for the studies of CTs and CT-exos treatment, the animal numbers used for surgery in the CTs, CT-exos, PBS-1 (control for CTs), PBS-2 (control for CT-exos) and sham groups were 14, 9, 14, 5 and 5, respectively. The survival rates of the CTs, CT-exos, PBS-1, PBS-2 and sham groups were 35.7% (5/14), 11.1% (1/9), 35.7% (5/14), 0% and 0%, respectively. As one animal in the CTs group, two animals in the CT-exos group and one animal in PBS-2 failed to undergo LAD ligation, the numbers in the CTs, CT-exos, PBS-1, PBS-2 and sham groups for final analysis were 8, 6, 9, 4 and 5, respectively. For the study of miR-21-5p treatment, the number of animals used for surgery in the miR-21-5p-, scramble and sham groups was 7, 7 and 5, respectively. The survival rates of the miR-21-5p-, scramble- and sham-treated groups were 14.3% (1/7), 14.3% (1/7) and 0%, respectively.
EchocardiographyTransthoracic echocardiograms were performed on experimental rats. The experimental rats were anesthetized with ketamine (100 mg/kg, i.p.). The echocardiographic measurements were then collected using an Acuson Sequoia 256c ultrasound system equipped with a 13-MHz linear transducer from a Vevo 2100 echocardiogram (VisualSonics, Canada). Briefly, the anterior chest wall was shaved, and the rat was placed in a left lateral decubitus position. A rectal temperature probe was inserted, and the body temperature was carefully maintained between 37 °C and 37.5 °C on a heating pad throughout the study. Parasternal long-axis, parasternal short-axis and 2 apical four-chamber views were collected in 2D-M-mode. The systolic and diastolic anatomic parameters were obtained from M-mode tracings at the mid-papillary level. The ejection fraction (EF) was calculated using the area-length method [19, 20].
Histological analysisThe extent of MI was measured at the level of the mid-papillary heart muscles and scored following Masson's trichrome staining. Paraffin sections were dewaxed and rinsed with water using routine protocols. After iron hematoxylin staining (7 min), the sections were stained with Ponceau acid fuchsin (5 min) and rinsed with distilled water. After differentiation using a phosphomolybdic acid solution (5 min), the sections were sequentially stained with aniline blue (5 min) and 1% acetic acid (1 min). After staining, the sections were dehydrated, cleared in xylene, and then mounted with resinene.
The infarct size, with linear approximations to account for area gaps in histology, is expressed as a percentage of the total LV myocardial area as our and others previously described [19, 20, 28, 30-32]. The collagen area of the infarct zone (CAIZ) is expressed as the ratio of the area of blue staining in the infarct zone to staining in the noninfarct zone using Image-Pro Analyzer 6.0 software. The perivascular collagen volume area (PVCA) is expressed as the ratio of the peripheral collagen area surrounding the small artery to the artery lumen area. The small arteries were selected for a detailed analysis at 40 × magnification, and the average was used as the definitive PVCA.
Immunohistochemistry and TUNEL stainingBlood vessel density in the infarct zone and border zone was measured using immunostaining for vWF. Immunohistochemical staining was performed on heart tissue samples using a rabbit vWF antibody (1:300; cat. no. F3520; Sigma), peroxidase-conjugated goat anti-rabbit IgG (cat. no. SA00001-2; Proteintech) and a DAB-Plus Staining Kit (cat. no. 00-2020; Life Technologies). The vWF+ blood vessels present throughout the infarct zone and border zone were photographed and counted under a microscope (20× magnification). The number of vessels per mm2 was compared among the different groups. The measurements were conducted in a double-blinded manner by two independent investigators.
The apoptotic endothelial cells were evaluated by TUNEL double staining (cat. no. KGA7063; KeyGene Biotech) and immunostaining for vWF (cat. no. F3520; Sigma) in the infarct zone 1 week after MI according to the manufacturer's protocols. Briefly, the paraffin sections at the mid-papillary level of the hearts were pretreated with 15 μg/ml proteinase K diluted with 10 mM Tris/HCl buffer (pH 7.4) for 15 min. After being rinsed with PBS, the sections were incubated with 50 μL of TUNEL reaction mix at 37 °C for 60 min. Next, the sections were incubated with 50 μL of streptavidin-TRITC labeling solution for 30 min at 37 °C. Then, the sections were blocked with 1% BSA for 1 h and incubated with anti-vWF (1:300) overnight at 4 °C. After the sections were washed, they were incubated with Alexa Fluor 488-conjugated secondary antibodies (1:1000) for 1 h and then incubated with Hoechst nuclear counterstain. The vWF+ and TUNEL+ cells were photographed and counted using confocal microscopy (FV3000, Olympus). The number of apoptotic endothelial cells per mm2 was compared among the different groups.
Statistical analysisAn independent samples t-test and one-way ANOVA with least significant difference (LSD) test were performed using SPSS version 17 software to determine the P-values in repeated experiments. All values are expressed as the mean± standard deviation (S.Dev). P < 0.05 was considered to indicate statistically significant differences.
Transplantation of CTs improved cardiac function, decreased infarct size and fibrosis, and enhanced angiogenesisWe isolated CTs according to the protocol described previously [19, 20]. The CTs (Figure S1) in this study showed the commonly accepted morphology and molecular marker features of telocytes [21-26]. These cells were more similar to interstitial cells than endothelial cells and progenitor stem cells. This deduction is supported by the following findings included in Figure S1: 1) the cells were positive for c-Kit, CD34 and Vimentin but negative for the endothelial cell markers CD31 and vWF (Figure S1B). 2) Cultured CTs did not show colony formation (Figure S1C) and entered growth arrest at approximately 10-15 passages when they were serially subcultured (data not shown). In addition, the collected CTs (passages 1~2) failed to be induced to differentiate into mesoderm-derived cells, such as bone and fat cells (Figure S1D). 3) The preliminary results of single-cell RNA sequencing revealed that the collected CTs were negative for the common stem cell markers Oct-4, SSEA-1 and Sca-1. In addition, they were positive for CD105, CD73 and Col1a1 (Figure S1E), which are commonly expressed by mesenchymal linage-derived interstitial cells.
Figure 1Transplantation of CTs and CT-exos improved cardiac function and decreased infarct size. A: Echocardiography revealed that transplantation of CTs significantly improved the (a) ejection fraction and (b) fractional shortening and significantly reduced the final (c) systolic as well as (d) diastolic diameter compared with those of the PBS-1 group. n = 5, 9, and 8 for the sham, PBS-1, and CT groups. In addition, echocardiography revealed that cardiac function measurements, including (a) ejection fraction, (b) fractional shortening, and (c) final systolic diameter but not (d) final diastolic diameter, of the CT-exos groups were significantly superior to those of the PBS-2 group. n = 5, 4, and 6 for the sham, PBS-2, and CT-exos groups. B: The infarct size of the CTs group was significantly smaller than that of the PBS group. n = 8, and 8 for the PBS-1, and CT groups. In addition, the infarct size of the CT-exos group was significantly smaller than that of the PBS-2 group. n = 4, and 5 for the, PBS-2 and CT-exos groups. *: p < 0.05, **: p < 0.01.
To test the therapeutic effects of these cells on MI, we injected the isolated CTs (5 × 105 cells) into the infarcted site and the border zone after MI caused by LAD ligation. Four weeks after the operation and CT transplantation, echocardiography showed that both critical indicators reflecting cardiac function, ejection fraction (EF) and fractional shortening (FS), were significantly improved in the CTs-treated group (Figure 1A a&b). Consistently, two geometrical parameters, left ventricular end-systolic diameter (LVESD) and left ventricular end-diastolic diameter (LVEDD), were significantly decreased in the CTs-treated group, indicating a recovery in ventricular filling and pumping function (Figure 1A c&d). Consistent with our previous reports [19, 20], injection of CTs significantly decreased infarct size (Figure 1B) and increased the density of the vWF+ vessels in the infarct and border zones (Figure 2A a-c, f, g). The collagen area of the infarct zone (CAIZ) (Figure 2B a-c, f) and the perivascular collagen volume area of the noninfarct zone (PVCA) (Figure 2C a-c, f) were likewise reduced. These observations demonstrated that transplantation of CTs can improve cardiac function and angiogenesis as well as reduce fibrosis and infarct size after MI.
Figure 2Transplantation of CTs and CT-exos increased angiogenesis and decreased fibrosis. A: The vessel density (vWF+) in the infarct and border zones of the CT group was significantly increased compared with that in the PBS group. n = 5, 6, and 6, for the sham, PBS-1, and CT groups. In addition, the vessel density (vWF+) in the infarct zone, but not the border zone, was significantly increased in the CT-exos group compared with the PBS group. n = 5, 4, and 5 for the sham, PBS-2, and CT-exos groups. Sham group (a). PBS-1-treated infarct zone (control for CT treatment) (b). CT-treated infarct zone (c). PBS-2-treated infarct zone (control for CT-exos treatment) (d). CT-exos-treated infarct zone (e). Semiquantitative analysis of the infarct zone (f). Semiquantitative analysis of the border zone (g). B: The collagen area of the infarct zone (CAIZ) of the CT group (a-c, f) and CT-exos group (a, d, e, f) was significantly smaller than those of the PBS-1 group and the PBS-2 group respectively. n = 5, 7, and 7 for the sham, PBS-1, and CTs groups. n = 5, 4, and 5 for sham, PBS-2, and CT-exos groups. Sham group (a). PBS-1-treated infarct zone (b). CT-treated infarct zone (c). PBS-2-treated infarct zone (d). CT-exos treated infarct zone (e). Semiquantitative analysis for a-e (f). C: The the perivascular collagen volume area of the noninfarct zone (PVCA) of the CT group (a-c, f) and CT-exos group (a, d, e, f) was significantly smaller than those of the PBS-1 group and the PBS-2 group respectively. n = 5, 7, and 7 for the sham, PBS-1, and CTs groups. n = 5, 4, and 5 for sham, PBS-2, and CT-exos groups. Sham group (a). PBS-1-treated noninfarct zone (b). CT-treated noninfarct zone (c). PBS-2-treated noninfarct zone (d). CT-exos treated noninfarct zone (e). Semiquantitative analysis for a-e (f). *: p < 0.05, **: p< 0.01.
As promoting angiogenesis and reconstructing the vessel network in ischemic myocardium is still a major challenge for the regeneration of MI, our present study aimed to identify possible mechanisms underlying the increase in angiogenesis. Consistent with the observation made by Popescu's group [33], our TEM studies also showed that CTs do exist in rat myocardium and showed unique morphology: a piriform, spindle or triangular shape with a nucleus that occupies approximately 25-30% or even more of the cell volume and very long, thin, dichotomously branched protrusions with a moniliform aspect called telopods, which are considered the 'ultrastructural hallmark' that distinguishes CTs from other interstitial cells (such as cardiac fibroblasts) [21-26] (Figure 3A). Moreover, we observed that CTs in rat myocardium shed exosomes (Figure 3B). These findings indicate that CT communication with CMECs to enhance the angiogenic potential of CMECs via CT-exos could be an endogenous function in the myocardium as well as one of the reasons for the increase in cardiac angiogenesis and the regenerative effects of CT therapy. Accordingly, CT-exos were collected to examine this hypothesis. The collected vesicles were confirmed to be exosomes by SEM (Figure 3C a), AFM (Figure 3C b), TEM (Figure 3C c), western blot analysis (Figure 3C d), dimension analysis (Figure 3C e), and NTA (Figure 3D and Supplementary video).
To determine the biological activity of the CT-exos, we used the same injection and analysis protocol described for the CTs to determine the therapeutic activity of the CT-exos in MI. The ability of the CT-exos to promote angiogenesis in ischemic myocardium was determined based on a significant increase in the density of vWF+ vessels in the infarct zone, but not in the border zone, compared with that in the PBS control group (Figure 2A a, d, e, f, g). In addition, the infarct size and related fibrosis (CAIZ and PVCA) were significantly reduced in the CT-exos-treated group compared with the control group (Figure 1B; Figure 2B a, d, e, f and Figure 2C a, d, e, f). Correspondingly, the cardiac function revealed by the echocardiography and geometrical parameters was significantly improved, which was supported by the cardiac function measurements, including (a) ejection fraction, (b) fractional shortening, and (c) final systolic diameter but not (d) final diastolic diameter, of the CT-exos groups; these parameters were significantly superior to those of the PBS group (Figure 1A). In summary, CT-exos possess the same therapeutic effects as CTs to promote regeneration following MI by increasing angiogenesis, decreasing the infarct as well as fibrosis size, and improving cardiac function when they were transplanted into the ischemic myocardium.
CT exosomes internalized by CMECs promoted the survival and inhibited the apoptosis of CMECs grown under ischemic-hypoxic conditions in vitroAs CTs improved angiogenesis and reduced infarct size, the potential of CMECs to serve as recipient cells of CT-exos was investigated in vitro. CT-exos were first labeled with DiI and then cocultured with CMECs for 6 h. Thereafter, the CMECs were labeled with LysoTracker (a probe for lysosomes) for 2 h. After this treatment, many DiI-labeled exosomes were detected in the cytoplasm (red fluorescence; Figure S2A a-c) and had not been transported to the lysosomes (green fluorescence; Figure S2A d). Thus, most of the CT-exos were internalized into CMECs but not targeted for early lysosomal degradation, at least within 8 h after engulfment. In addition, a transwell assay between CTs and CMECs demonstrated that the CT-derived exosomes can be secreted, targeted and engulfed by CMECs. For confirmation of this finding, CTs with extensive washing after they were stained by calcein (green) and Dil (red) were added in the upper chamber and cocultured in the lower chamber, which was seeded with CMCEs, for 48 h. It was found that approximately 95% and 51% of the CMCEs were green and red, respectively, in the lower chamber by flow cytometry (Figure S2B a-c; Figure S2C a-c). In parallel, scattered green and red fluorescent dots were found in the treated CMCEs of the lower chamber by microscopy (Figure S2B d; Figure S2C d).
The protective effect of CT-exos on CMEC survival under normoxia and ischemia-hypoxia was further investigated by CCK-8 assays. The CCK-8 values of the CT-exos-treated CMECs under both normoxia and ischemia-hypoxia were significantly higher than those of the PBS-treated controls (Figure 4A). In addition, the apoptosis and cell death of the CT-exos-treated CMECs under ischemic-hypoxic conditions, revealed by Annexin V/PI flow cytometry assays, was significantly reduced compared with that of the PBS-treated controls, but these results were not found under normoxia (Figure 4B and Figure S3A). Furthermore, wound healing assays showed that the migration distance of CT-exos-treated CMECs was significantly longer than that of the PBS-treated CMECs 24 h after treatment (Figure S3B). In addition, the tube formation assay demonstrated that the tubular network of the tube formed for the CT-exos-treated CMECs in both normoxic and ischemic-hypoxic conditions was significantly better than those of the PBS-treated CMECs (Figure 4C). Taken together, the results indicate that the CMECs were recipient cells for CT-exos. After uptake into CMECs, CT-exos may remain in the cytoplasm to maintain the survival, migration, and tube formation of CMECs under normoxia and exert antiapoptotic and proangiogenic effects under ischemic-hypoxic conditions.
Figure 3Cardiac telocytes present a unique morphology and secreted exosomes. A: Transmission electron microscopy images of CT (blue) in the myocardium show a unique morphology: a piriform, spindle or triangular shape with a nucleus that occupies approximately 25-30% of the cell volume and very long, thin, dichotomously branched protrusions with a moniliform aspect called telopods. B: CTs secrete exosomes (white arrow). C: (a-c) Scanning electron microscopy, atomic force microscopy and transmission electron microscopy images of the collected CT-exos confirm that the morphology and diameter are consistent with exosomes. (d) Western blots confirmed that the collected CT-exos are positive for CD63. (e) Relative frequency analysis of the diameter of the CT-exos. D: Nanoparticle tracking analysis (NTA) of the CT-exos. (a) Representative NTA image of the CT-exos. (b) Relative frequency analysis of the diameter of the CT-exos by NTA. The collected vesicles were confirmed to be exosomes by the above evidence.
CTs exosomes facilitated survival and inhibited apoptosis in CMECs and enhanced angiogenesis in ischemic-hypoxic conditions in vitro, and CT-miR-21-5p was identified as a key functional molecule. A: The cell viability of CMECs incubated with CT-exos, CT-exos-miR21KO or PBS under normoxia and ischemia-hypoxia. B: Annexin V/PI staining and flow cytometry of CT-exos-, CT-exos-miR21KO-, PBS- or blank-treated CMECs cultured under normoxic and ischemic-hypoxic conditions for 24 h. C: Tube formation assay of CMECs incubated with CT-exos, CT-exos-miR21KO or PBS under normoxic and ischemic-hypoxic conditions for 8 h. The above studies (A-C) were conducted using two animals in at least three repeated experiments for each individual animal. D: The 10 most abundant miRNAs in CT-exos according to RNA sequencing, and miRNA-21-5p is the most prevalent miRNA. E: miR-21-5p expression levels in CMECs incubated with PBS, CT-exos or CT-exos-miR21KO for 24 h. F: (a) Schematics of the transwell assays of CT-exos for CMECs. (b) Flow cytometry analysis for CMECs which was cocultured with no CTs in the upper chamber for 48 h. (c) Flow cytometry analysis for CMECs (lower chamber) cocultured with CTs transfected by the synthesized miR-21-5p-FAM (green) in the upper chamber for 48 h. The green-stained CMCEs in the lower chamber comprised approximately
Comments (0)