ORIGINAL ARTICLE
Year : 2022 | Volume
: 49
| Issue : 3 | Page : 272-276
Association of SNP rs163550 in IL5RA Gene with Risk of Preeclampsia
Nagarjuna Sivaraj1, K Vijaya Rachel1, Tarun Kumar Suvvari2, Shilaja Prasad3, Sriharsha Boppana4, Vineetha Naidu4, Pradeep Kumar Vegi5, Youssef Aboufandi6, LV Simhachalam Kutikuppala7
1 Department of Biochemistry and Bioinformatics, GITAM Deemed to be University, Visakhapatnam, Andhra Pradesh, India
2 Final year MBBS, Rangaraya Medical College, Srikakulam, Andhra Pradesh, India
3 Department of Obstetrics and Gynecology, Great Eastern Medical School and Hospital, Srikakulam, Andhra Pradesh, India
4 Department of General Medicine, Central Research Laboratory, Great Eastern Medical School and Hospital, Srikakulam, Andhra Pradesh, India
5 Department of Biochemistry, Great Eastern Medical School and Hospital, Srikakulam, Andhra Pradesh, India
6 Department of Medicine, Medical University of Sofia, Sofia, Bulgaria
7 Intern, Konaseema Institute of Medical Sciences and Research Foundation, Amalapuram, Andhra Pradesh, India
Correspondence Address:
Dr. K Vijaya Rachel
Department of Biochemistry and Bioinformatics, GITAM Deemed to be University, Visakhapatnam, Andhra Pradesh
India
Source of Support: None, Conflict of Interest: None
CheckDOI: 10.4103/jss.jss_70_22
Background: Several research have looked at the significance of SNPs in inflammatory mediator genes and their link to preeclamptic pregnancies, but the results have not been conclusive enough to explain why SNPs in inflammatory mediator genes may increase the risk of preeclampsia. The goal of this study is to analyze the IL5RA SNPs in order to learn more about the possible link between preeclampsia and inflammatory genes. Materials and Methods: A total of 304 pregnant participants were a part of this prospective observational case-control study, out of which 152 had preeclampsia, and the other 152 participants had normotensive pregnancies. The “polymerase chain reaction-restriction fragment length polymorphism” method was used to genotype SNP rs163550. Results: The commonness of the IL5RA rs163550G allele has been linked to an increased risk for preeclampsia with P value: 0.0230 and odds ratio: 0.6818 (95% confidence interval: 0.489–0.9505). Conclusion: A prominent association among the IL5RA rs163550 SNP and preeclampsia in comparison to nonpreeclampsia has been observed in the study. The study stands first to report IL5RA Polymorphism association with the pathogenesis of preeclampsia's among the Indian population.
Keywords: Gene IL5RA, inflammation, interleukins, preeclampsia, SNP

In the course of 20th week during pregnancy, preeclampsia is defined as a progressive maternal hypertension, proteinuria, edema, and basic coagulopathies.[1] Preeclampsia is associated with pregnancy-associated risks such as intrauterine growth retardation, preterm labor, maternal, and fetal morbidity and mortality.[2],[3] Due to the rapid and gradual progression of disease conditions, the markers of preeclampsia can be ranging from mild to severe, according to the “American College of Obstetrics and Gynecology” (ACOG, 2002). Preeclampsia has no established etiology; nonetheless, the link between the placental, genetic, invulnerable, and maternal factors is important. The worldwide incidence of preeclampsia ranges from 5% to 8%, whereas in India it accounts for 28%.[4],[5] Women in developing countries are likely to develop higher rates of preeclampsia than in developed countries, with a mortality rate of almost 10%–25%.[6]
The cause of the disease is unknown, however, one of its main characteristics is the malfunction of maternal bodily endothelial cells. Uteroplacental ischemia and dissemination are thought to be caused by shallow trophoblast invasion and placentation in the maternal endometrium (decidua).[7] Inflammatory plasma components such as C-reactive proteins, intracellular adhesion molecules, and cytokines, among others, have a role in preeclampsia's acute and long-term inflammatory state alterations.[8] Recent evidence suggests that a strong maternal inflammatory response coupled with endothelial-mediated cytokine damage may play a role in the pathophysiology of preeclampsia.[9] Increased release of inflammatory cytokines such as tumor necrosis factor (TNF-) or interleukin 1a (IL1a), IL1b, which can produce preeclampsia with endothelial dysfunction, is linked to possible ischemia and placental hypoxia. Several studies have looked at SNPs in inflammatory mediator genes and their association with preeclamptic pregnancies, but the results have not been conclusive enough to explain why SNPs in inflammatory mediator genes may have a role in the risk of preeclampsia.[9] The goal of this study is to analyze the IL5RA SNPs in order to gain insights in to the possible link between preeclampsia and inflammatory genes.
Materials and Methods
Study design
Three hundred and four women were involved in this prospective observational case–control study; 152 had preeclampsia, while 152 had normotensive pregnancies. They participated over a period of 2018–2020, from the Obstetrics and Gynecology Department, Great Eastern Medical School (GEMS) Hospital, Srikakulam, India. Identification and risk evaluation of preeclampsia were adhered to according to the principals of ACOG, 2002 guidelines.[10] Women who were not hypertensive or experiencing any other complications during pregnancy were considered a control group.
Sample collection and isolation of DNA
In both subjects with preeclampsia and the controls, 3 mL of blood sample was drawn from the veins with an EDTA vacationer. The blood samples were kept at 4°C until the DNA processing was finished.[11] We then used a spectrophotometric method to assess the DNA's purity (“Systronics UV/Vis 119 PC model”), and stored the purified DNA samples at 20°C.
Genotyping of SNP
By using primers for the 5'tggctcccatctaacctc3' (Forward) and 5'tggcctcccatctgtaacctc3' (Reverse), we amplified the IL5RA rs163550 gene. The polymerase chain reaction (PCR) was performed with a 20 μl reaction mix, which included: 100 ng of genomic DNA, 1X assay buffer, 10 pmol of each primer, 0.2 mM dNTPs and, 1.5 mM Magnesium chloride. All chemicals procured from GeNei, Bengaluru, India. The PCR commences with a preliminary denaturation at 95°C for 7 min, followed by 45 cycles of 95°C for 1 min denaturation; 61°C (IL5RA, rs163550) annealing for 30 s, 72°C for 30 s of extension; and 72°C for 7 min as the final extension step. Analyses of the PCR amplicon were done on 1% agarose gel electrophoresis with the amplicons tested on 100 bps molecular weight markers. On a 1% agarose gel, an amplified PCR product was examined. Amplified 229 bps DNA was assimilated for 10 h at 37°C with 10U Hae-III restriction enzyme (“BioLabs, Ipswich, USA”), and alleles were observed with the Gel Doc System on two percent agarose gels stained with ethidium bromide (GeNei). As a positive control, a test sequenced by Sanger with the CC genotype was used to show the G allele as a whole 192 bp piece and the C allele as 150 bp and 42 bp sections and we have compared the restriction fragment length polymorphism pattern between the control and the cases.
Statistical analysis
Clincal's web tool was used to calculate sample sizes with an interval of 95% and a power of 70%. The Open Epi online tool was used to evaluate the data, where the mean, standard deviation, and percentage were used to calculate the parametric variables. Student's t-tests were used to calculate the significance level. A quick Hardy Weinberg Calc was used to examine the sample population for Hardy–Weinberg Equilibrium. To have statistically significant statistics, we employed Fisher's exact technique to evaluate genotype and allele distribution between the two groups, comparing with the P value (P < 0.05).[12]
Ethical aspects
All subjects gave their informed consent, and the GEMS and Hospital's Institutional Ethics Committee authorized the study. There was no conflict between the study protocol and any medical advice or medications.
Results
A sum of 304 individuals were included in this prospective observational case–control study, out of which 152 had preeclampsia pregnancies and the other 152 participants had normotensive pregnancies. The study participants are in the range of mean age (23.23 ± 3.08 years in cases vs. 23.21 ± 3.04 years in controls) and gestational age (35.3 ± 1.8 weeks in cases vs. 40.2 ± 1.1 weeks in controls). 61.8% of cases were primigravida and 38.2% were multigravida. So, we can observe the association of preeclampsia with primigravida and multigravida pregnancies respectively in this study. The findings of the study also show that women with severe preeclampsia (43%) are less common than those with mild preeclampsia (57%). The preeclampsia was mild in 57% (86) of the cases and severe in the 43% (66) of the cases. The blood pressure among mild preeclampsia and severe preeclampsia patients was 140.4 ± 1.4/93.2 ± 9.58 mmHg and 167.5 ± 18/103 ± 11 mmHg, respectively. The blood pressure among normotensive patients was 110.5 ± 8.8/71.8 ± 8.5 mmHg. The proteinuria was mild in the 86 preeclampsia patients (56.5%) and severe in 66 preeclampsia patients (43.5%).
The incidence of G allele was more common among the case group (55.9%) than in controls (46.3%) and can be seen [Table 1]. The disparity in the allele distribution among cases and controls was observed to be significant statistically (P = 0.0230). The odds ratio (OR) for the incidence of CG allele in cases was 0.6818 with 95% confidence interval (CI): 0.489–0.9505. Classifying the patients into mild and severe preeclampsia doesn't change the OR significantly [Table 2]. While analyzing the IL5RA rsC 163550G polymorphism among cases and controls, both groups' genotypes were in agreement with Hardy–Weinberg equilibrium.
Table 2: Genotypic and allelic interpretation of IL5RA gene among preeclampsia subjectsIn [Table 1], the incidence of G allele is lower in controls (46.3%) than in cases (55.9%). The incidence of CG and GG genotypes were more in preeclampsia subjects over the control group. Interpretation of genotypes among preeclampsia subjects and the statistical analysis can be evident in [Table 2]. OR for beginning of preeclampsia was 1.183 (95% CI: 0.6891–2.036) in the dominant group for G allele, whereas it was 0.381 (95% CI: 0.2031–0.7017) in the recessive model. The link between recessive GG models and mild preeclampsia was stronger than the link between recessive GG models and severe preeclampsia, and it was only detected in recessive models.
Discussion
SNP rs163550 in IL5RA gene has been found to be associated with preeclampsia in comparison to normotensive pregnant women in our study. We found that the gestational age of preeclampsia patients differed significantly from that of normotensive pregnant women, and this study supports earlier research that has indicated that gestational age is one of the risk factors for preeclampsia, which can develop to eclampsia.[13],[14] Mrema et al. revealed in a Tanzanian study that pregnant women over the age of 35 have a 2.6 times higher risk of experiencing preeclampsia than younger moms.[15] Unlike the previous study, ours found no significant differences (P = 0.870) between preeclampsia and normotensive age categories.
By this study, we set off that preeclampsia was more common in primigravida compared to multigravida participants. These findings are consistent with those of case-control research conducted by Reyes et al., which found that numerous factors contribute to the risk of preeclampsia.[16] However, in developing countries, primigravidae have a higher risk of developing and advancing preeclampsia. Wodajo and Reddy discovered that multigravida women have a 3.4 times higher risk of preeclampsia than women who are pregnant for the first time.[17] They hypothesized that as the incidence of psychological stress rises, so does the risk of developing a bulky placenta, which reduces placental perfusion.
Furthermore, due to inflammation, obesity placed participants at a greater risk for preeclampsia. Adipose tissues produce numerous inflammatory intermediaries that can alter the endothelial role, and it is fascinating that these intermediaries' preponderance seems to be prepared more aggressively in adipose tissues of overweight people.[18] A significant increase in inflammatory markers is associated with cardiovascular diseases, including preeclampsia. Few more studies proved that IL-6 and TNF alpha markers have an association with preeclampsia in obesity.[19],[20] Consequently, research from our group reveal is an association of 163550 G allele in the IL5RA gene with an elevated susceptibility to mild preeclampsia. We also observed insignificant differences in the hematological parameters, including white blood cell, hemoglobin, red blood cell, platelet count and mean cell volume, which are shown in [Table 1]. These findings are relatively similar to the results of Makuyana et al.[21] As SNPs are front line biomarkers in disease diagnosis, they gained importance in disease association studies in the recent era.[22],[23] Hence, we focused on IL5RA 163550 SNP's and its association in preeclampsia. In order for a genetic mutation to occur, a single nucleotide must be inserted, deleted, or transverted, where SNP has been demonstrated to be a critical element in human disease vulnerability.[24] Individuals who carry IL5RA rs163550 polymorphisms may have cytokine levels and reaction strength that are affected by the inflammatory factor. This may be linked to the development of many diseases. Polymorphism IL5RA rs163550 was found in dominant, codominant, and recessive models to be associated with preeclampsia risk. The study evaluated the differences between normotensive and preeclamptic pregnancies in Indian populations based on IL5RA163550SNP polymorphism. Prior to these findings, two investigations from Taiyuan, China, and Seattle, Washington[25],[26] found a link between PE and the IL5RA rs163550 polymorphism. As far as we know, this is the first study in India to confirm a link between the IL5RA rs163550 polymorphism and an elevated risk of preeclampsia. The findings of this study reveal a statistically significant link between the IL5RAGG genotype and an increased risk of preeclampsia; however, in the Taiyuan population, a relationship between IL5RA 163550CC and an increased risk of preeclampsia was discovered.[26] The association of IL5RA rs163550 with preeclampsia has not been investigated in other Indian studies. The IL5RA rs163550 genotypic summary Polymorphism aided the progression of inflammatory disorders such eosinophilic leukemia, sporadic IgA nephropathy, rhino conjunctivitis, eczema, asthma, and atopy, among others.[27],[28],[29],[30] All the studies that show a presence and absence of association with GG genotype have been reported. Carriers of the GG allele were at higher risk of advancing preeclampsia, but only in recessive models.
Yoneyama et al. observed that T-helper 2 cells produced a variety of inflammatory cytokines, such as ILs 5, 4, 6 and 10, which could inhibit cellular immunity, increase placental growth and improve the quality and function of cell inflammatory cytokines.[31] The IL5RA is a specific receptor of IL 5 that pinions to IL5, which also triggered more than three signaling pathways with Btk, Ras/ERK, and JAK2/STAT5.[32] In contrast to the trophoblastic programmed cell death and aponecrosis that have been linked to preeclampsia as key pathogenic measures, Ras/ERK pathway stimulation can aid in cell propagation and persistence.[33] Our investigation clearly shows that IL5RA triggering the preeclampsia and also our previous study of IL1R1 is also having the association with this pathway.[34]
The polymorphisms in IL5RA (rs163550) were associated with overall preeclampsia in the current study. The genotype on the other hand was measured and the overall recessive model of preeclampsia with a P = 0.012 with the OR of 0.3812 (95%CI: 0.2031–0.7017) is strongly associated with the risk of preeclampsia when compared with the dominant model, P = 0.604; OR = 0.6040 (95% CI: 0.6891–2.036). IL5RA polymorphism 163550G allele polymorphism has a strong association with preeclampsia risk. The IL5RA dominant type and preeclampsia prognosis were also investigated, and no significant association was found between the IL5RA 163550C allele and this disease. In order to confirm our findings, we need advanced studies. The drawback of this study is that all of the participants were picked from a single hospital. It is also likely that genes other than IL5RA rs163550 and other SNPs play a role in the prognosis of preeclampsia., and consequent evaluation of the Il5RA activity was required for each trimester.
Conclusion
The findings of this study show a link between the IL5RA rs163550 SNP and preeclampsia in comparison to nonpreeclampsia women. Preeclampsia's pathogenesis differed by preeclampsia subtypes such as mild, moderate, and severe and this study was the first to show a link between IL5RA polymorphism and pathogenesis in the Indian population. Evaluation of IL5RA activity in each trimester of preeclampsia, eclampsia, and placental contribution to any IL5RA activity requires further research.
Acknowledgment
The principal author, Nagarjuna Sivaraj is grateful to the “Great Eastern Medical School”, Srikakulam for its support. We would like to thank Dr. Sharath Balakrishna, Research Coordinator in Sri Devaraj Urs University for helping in statistical analysis part.
Ethical approval
The Institutional Ethical Committee of GEMS, Srikakulam and Hospital authorized this research.
Informed consent
Taken from all study participants.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
References



































Comments (0)