ORIGINAL ARTICLE
Year : 2022 | Volume
: 18
| Issue : 7 | Page : 1919-1925
Tumor-suppressive role of microfibrillar associated protein 4 and its clinical significance as prognostic factor and diagnostic biomarker in hepatocellular carcinoma
Jie Li1, Jianguo Wang1, Zhikun Liu1, Haijun Guo1, Xuyong Wei1, Qiang Wei1, Shusen Zheng2, Xiao Xu3
1 Key Laboratory of Integrated Oncology and Intelligent Medicine of Zhejiang Province, Department of Hepatobiliary and Pancreatic Surgery, Affiliated Hangzhou First People's Hospital, Zhejiang University School of Medicine, Hangzhou, China
2 Division of Hepatobiliary and Pancreatic Surgery, First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China
3 Key Laboratory of Integrated Oncology and Intelligent Medicine of Zhejiang Province, Department of Hepatobiliary and Pancreatic Surgery, Affiliated Hangzhou First People's Hospital, Zhejiang University School of Medicine; NHC Key Laboratory of Combined Multi-Organ Transplantation; Institute of Organ Transplantation, Zhejiang University, Hangzhou, China
Correspondence Address:
Xiao Xu
261# Huansha Road, Hangzhou, Zhejiang
China
Source of Support: None, Conflict of Interest: None
CheckDOI: 10.4103/jcrt.jcrt_693_22
Objective: Revealing microfibrillar-associated protein 4 (MFAP4)'s function and its clinical significance in hepatocellular carcinoma (HCC).
Methods: Quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting were used to evaluate MFAP4 mRNA and protein expression in paired HCC and paracarcinoma tissues, respectively. MFAP4 serum concentration was detected using enzyme-linked immunosorbent assays in healthy people (n = 30), cirrhosis (n = 15) and HCC patients (n = 80). MFAP4 protein expression was detected in two tissue microarrays (n = 60 and n = 90). Plasmids were transfected into human HCC cell line Bel-7402, and MFAP4 function was determined in vitro in cell experiments. Furthermore, tumorigenicity studies in nude mice served to assess the function of MFAP4 for HCC.
Results: Both MFAP4 mRNA and protein expression were significantly downregulated in HCC tissue compared with paracarcinoma tissue (P < 0.05). Decreased MFAP4 expression in paracarcinoma tissue was associated with poor postoperative survival in HCC patients (P = 0.027). MFAP4 was also downregulated in HCC sera compared with healthy people (P < 0.05). In vitro, MFAP4 upregulation in Bel-7402 cells induced S phase arrest, promoted apoptosis, and inhibited migration and invasion. Western blotting indicated MFAP4 overexpression increased CDK4, CDK6, pRB, P27, and BCL-XS expression. Tumorigenicity study showed that the upregulation of MFAP4 inhibited the proliferation of Bel-7402 cells in nude mice.
Conclusions: MFAP4 expression was significantly lower both in sera and tissue of HCC patients. MFAP4 can serve as molecular marker for HCC diagnosis and prognosis. Additionally, MFAP4 acted as an important HCC tumor suppressor by inducing S phase arrest, and promoting apoptosis, cell migration, and invasion.
Keywords: Biomarker, hepatocellular carcinoma (HCC), microfibrillar associated protein 4 (MFAP4)

Hepatocellular carcinoma (HCC) is one of the most common and severe malignant tumors in the world.[1] In recent years, with the development of medical image, surgery and so on, the diagnosis and treatment of HCC has already made great progress. But the cellular mechanisms of hepatocarcinogenesis remain poorly understood and there are still many problems such as the lack of effective diagnostic markers, low survival rate and high recurrence rate in HCC patients.[2]
MFAP4 has been found to paly roles in many cancers, such as prostate cancer, limited breast cancer, and urinary bladder cancer.[3],[4],[5] However, there is little available data on the role of MFAP4 in HCC so far. The aim of this research was to reveal the underlying mechanism of MFAP4 in HCC.
> Material and Methods
Human samples
HCC and paracarcinoma tissues, and HCC and control group sera were used in this study. Clinical samples were obtained from patients with HCC who underwent a hepatectomy at the First Affiliated Hospital, College of Medicine at Zhejiang University. This study was approved by the Ethical Committee at the hospital, and each patient provided written informed consent. Tissue microarrays, including HLiv-HCC180Sur-01 and HLiv-HCC060CD-01 (SHANGHAI OUTDO BIOTECH CO., LTD, China), were used for immunohistochemistry. HLiv-HCC060CD-01 contains different types of liver tissues, including normal liver tissues (n = 2), liver cirrhosis tissues (n = 14), paired HCC and paracarcinoma tissues (n = 15), and HCC metastatic tissues in other organs (n = 9). A total of 90 pairs of HCC and paracarcinoma tissues were included in the tissue microarray HLiv-HCC180Sur-01.
Cell line
The human HCC cell line Bel-7402 (Chinese Academy of Sciences, Shanghai, China) was used in the present study. Bel-7402 cells were cultured in Roswell Park Memorial Institute medium 1640 supplemented with 10% fetal bovine sera (FBS) at 37°C in 5% CO2.
MFAP4 plasmid transfection
Human MFAP4 cDNA was sub-cloned into the mammalian expression plasmid EX-LV 201 (GeneCopoeia, Guangzhou, China) to generate the MFAP4 overexpression plasmid. MFAP4 overexpression and negative control plasmids were then transfected into Bel-7402 cells using Lipofectamine 2000 transfection reagent (Invitrogen, USA); the transfection was completed according to the manufacturer's instructions. Bel-7402 cells transfected with the MFAP4 overexpression plasmid were called Bel-7402-MFAP4, and Bel-7402 cells transfected with the negative control plasmid were called Bel-7402-NC. Transfection efficiency was validated by Western blotting (WB) after 48 h plasmid transfection.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Before synthesizing cDNA using M-MLV Reverse Transcriptase (TaKaRa, Japan), RNA was extracted using Trizol (Invitrogen, USA). Subsequently, qRT-PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, USA) and the ABI Prism 7500 fast sequence detection system (Applied Biosystems, USA). The following primer sequences were used: MFAP4: Forward Primer (5′-3′), TACCAGTCAGACGGCGTGTA and Reverse Primer (5′-3′), CCACTCGCAGCTCATACTTCT; GAPDH: Forward Primer (5′-3′), TGTGGGCATCAATGGATTTGG and Reverse Primer (5′-3′), ACACCATGTATTCCGGGTCAAT.
The results were calculated using the 2−ΔΔCt method, and GAPDH was used as internal control. Each sample was detected in triplicate.
Enzyme-linked immunosorbent assays (ELISAs)
An ELISA kit from Cloud-Clone Corp (USA; product number MAF589Hu21), was used for these assays performed according to the manufacturer's instructions.
Immunohistochemistry
Immunohistochemistry was performed with tissue microarrays, including HLiv-HCC180Sur-01 and HLiv-HCC060CD-01. After deparaffinization, the microarray was placed in ethylenediaminetetraacetic acid buffer for antigen repair using a microwave oven. Then, the microarray was blocked for 30 min at room temperature with TBS containing 5% bovine sera albumin (BSA). After washing three times with phosphate-buffered solution (PBS), the MFAP4 primary antibody was added to the microarray, and the microarray was then incubated overnight at 4°C in the dark. After washing three times with PBS, the microarray was incubated with the secondary antibody for 1 h at room temperature. Diaminobenzidine was used as chromogenic substrate. After counterstaining with Mayer's hematoxylin, the microarray was dehydrated, cleared and mounted. The staining reaction was evaluated according to the immunoreactive score.[6] Two experienced pathologists independently scored the results.
Cell migration and invasion assay
A 6.5-mm transwell containing a sterile polycarbonate membrane insert with an 8.0 μm pore (Corning Incorporated, USA) and Matrigel (BD, USA) were used for cell migration and cell invasion assays. For the cell migration assay, 5 × 105 cells in 200 μL of serum-free medium were seeded onto the transwell chamber, and 800 μL of 1640 medium supplemented with 10% FBS was added to a 24-well plate. After 48 h, the cells that migrated to the bottom of the chamber surface were fixed with methanol and stained with 0.1% crystal violet. Non-migrating cells were removed from the upper surface by wiping with a cotton swab. The migrated cells were photographed using digital microscopy at randomly selected fields. For the cell invasion assay, Matrigel was mixed with serum-free 1640 medium at a 1:8 ratio, and 30 μL of the mixture was added to the transwell chamber before seeding the cells. After 72 h, cells invading the bottom of the chamber surface were fixed with methanol and stained with 0.1% crystal violet. Non-invading cells were removed from the upper surface by wiping with a cotton swab. Both cell migration and cell invasion assays were performed in three independent experiments.
WB and antibodies
Proteins were extracted from HCC and paracarcinoma tissues by radio-immunoprecipitation assay. The protein concentration was measured using BCA protein assay reagent. Proteins were then solubilized in 4× loading buffer at a final concentration of 2 μg/μL. Next, 20 μg of protein was denatured at 95°C for 5 min followed by separation using SDS-polyacrylamide gel electrophoresis on 10% polyacrylamide gels. After electrophoresis, the proteins were transferred onto polyvinylidene fluoride membranes with a pore size of 0.45 μm. The membranes were blocked for 1 h at room temperature with TBS containing 5% BSA, followed by incubation with the primary antibody overnight at 4°C. The following primary antibodies were used in the present study: anti-MFAP4 (Abcam, ab103925, USA), anti-β-actin (Abcam, ab8226, USA), anti-p27 (Abcam, ab75908, USA), anti-CDK6 (Abcam, ab124821, USA), anti-CDK4 (Abcam, ab108357, USA), anti-pRB (CST, 8516S, USA), and anti-BCL-X (Proteintech, 10783-1-AP, China). The membranes were washed three times with TBS containing 0.1% Tween-20 (TBST) and then incubated with a secondary antibody according to the primary antibody source for 2 h at room temperature. Immunodetection was performed using an enhanced chemiluminescence (ECL) detection kit. All antibodies were diluted in TBST containing 5% BSA, and β-actin was used as internal standard.
Cell proliferation assays
Bel-7402-MFAP4 and Bel-7402-NC cells were seeded onto 96-well plates (5000 cells in each well). Then, cells were maintained for 24, 48, 72, and 96 h. CCK-8 (Dojindo, Japan) was then added to each well, and cells were incubated at 37°C for 2 h. Optical density (OD = 450 nm) was measured according to the manufacturer's instructions. The assay was performed in three independent experiments.
Apoptosis and cell cycle analysis by flow cytometry
Prior to flow cytometry analysis, cells were collected and washed with ice-cold PBS. For the cell apoptosis assay, cells were then stained with Annexin V-FITC (BD Bioscience, CA) and propidium iodide for 15 min at room temperature in the dark. For the cell cycle assay, cells were fixed with ice-cold 75% ethyl alcohol overnight at 4°C and stained with propidium iodide (BD Bioscience, CA) at room temperature for 20 min in the dark. After staining, cells from both assays were analyzed using a flow cytometer (BD LSR II, USA). Both assays were performed in three independent experiments.
Recombinant lentivirus construction and subcutaneous tumor formation
To further explore MFAP4 function in vivo, a recombinant lentivirus was constructed using the above referred plasmids by Shanghai Genechem Co., Ltd. The recombinant lentivirus stably expressing MFAP4 was called LV-MFAP4. The recombinant lentivirus constructed with the negative control plasmid was called LV-NC. Then, LV-MFAP4 and LV-NC were transfected into Bel-7402 cells, respectively. The transfection efficiency was validated by WB. Bel-7402 cells transfected with LV-MFAP4 or LV-NC were used for nude mice tumorigenesis.
Animal experiments were performed in accordance with The Guide for Care and Use of Laboratory Animals at Zhejiang University. Male BALB/C nude mice were purchased from the Wuhan University Center for Animal Experiments (China) and maintained at the Experimental Animal Center of the First Affiliated Hospital, Zhejiang University School of Medicine. The subcutaneous tumor formation assay was conducted in 16 male BALB/C nude mice divided randomly into two groups. Two million Bel-7402-MFAP4 or Bel-7402-NC cells were subcutaneously injected into each nude mouse. After three weeks, the tumor size in each mouse was measured.
Statistical analysis
Statistical analysis was performed using Statistical Package for the Social Sciences software (SPSS 16.0, Chicago, IL, USA). Images were acquired using GraphPad Prism software version 6.0. Numerical data are expressed as the mean ± standard deviation (SD), and P < 0.05 was considered statistically significant.
> Results
MFAP4 was downregulated in HCC tissues compared with their paracarcinoma tissues
In 63 paired HCC and paracarcinoma tissues, the expression of MFAP4 mRNA was significantly lower in HCC tissues compared with the paracarcinoma tissues [Figure 1]a. In 8 paired HCC and paracarcinoma tissues, the expression of MFAP4 was also significantly lower in HCC tissues compared with the paracarcinoma tissues [Figure 1]b. As the progression of HCC, the expression of MFAP4 gradually downregulated, although there was no statistical difference [Figure 1]c. In 90 paired HCC and paracarcinoma tissues, the expression of MFAP4 was significantly lower in HCC tissue compared with paracarcinoma tissue [Figure 1]d. The expression of MFAP4 was almost identical in different HCC tissues (almost undetectable), but MFAP4 expression changed in different paracarcinoma tissues. With respect to survival, we found that HCC patients who had higher MFAP4 expression in their paracarcinoma tissues had a longer overall survival rate [Figure 1]e.
Figure 1: MFAP4 downregulation in HCC could be a potential prognostic marker for HCC. (a) MFAP4 mRNA expression was lower in HCC tissues than in paracarcinoma tissues in 63 paired tissues (P < 0.05). P: paracarcinoma tissues; C: HCC tissues. (b) The expression of MFAP4 was significantly lower in HCC tissues compared with paracarcinoma tissues (P < 0.05). (c) MFAP4 expression was gradually downregulated with HCC progression, but with no statistical difference (P < 0.05). (d) MFAP4 expression was significantly lower in HCC tissues than in paracarcinoma tissues in 80 paired tissues (P < 0.05). (e) HCC patients with higher MFAP4 expression in their paracarcinoma tissues had a longer overall survival rate (P = 0.021)MFAP4 was down-regulated in the sera of HCC patients
Since MFAP4 is a secreted protein, its expression was also detected in sera to explore further potential clinical applications of MFAP4. The correlation between MFAP4 expression and pathological features was analyzed as shown in [Table 1]. The results showed that MFAP4 serum concentration in HCC patients was significantly correlated with patient sex. MFAP4 serum concentration in male HCC patients was significantly higher than in female HCC patients (P = 0.000).
Table 1: The correlation between clinicopathological characteristics and the serum concentration of MFAP4 of HCC patientsThen we compared MFAP4 serum concentration in these three sets of samples:
Healthy people vs HCC patients: MFAP4 was downregulated in the sera of HCC patients (P < 0.05) [Figure 2]a. The area under curve (AUC) of the response characteristic curve (ROC) was 0.860. MFAP4 could be a potential diagnostic marker to distinguish between healthy people and HCC patients (P < 0.05) [Figure 2]b. The Youden index (YI) was 14.7365. When the MFAP4 serum concentration was <14.7365 ng/mL, the sensitivity and specificity to diagnose HCC were 0.967 and 0.738, respectively.Healthy people vs cirrhosis patients: MFAP4 was downregulated in the sera of cirrhosis patients (P < 0.05) [Figure 2]a. The AUC of the ROC was 0.846. MFAP4 could be a potential diagnostic marker to distinguish between healthy people and cirrhosis patients (P < 0.05) [Figure 2]c. The YI was 18.934. When the MFAP4 serum concentration of was <18.934 ng/mL, the sensitivity and specificity to diagnose cirrhosis were 0.867 and 0.8, respectively.Cirrhosis patients vs HCC patients: There was no significant difference in MFAP4 expression between these two groups (P > 0.05) [Figure 2]a. However, MFAP4 could be a potential diagnostic marker to distinguish between patients with cirrhosis and HCC patients (P < 0.05) [Figure 2]d. The AUC of the ROC was 0.729, and the YI 4.6708. When serum MFAP4 concentration was < 4.6708 ng/mL, the sensitivity and specificity to diagnose HCC were 1.0 and 0.6, respectively.
Figure 2: MFAP4 downregulation in the sera of HCC patients could be a potential molecular marker for HCC diagnosis.(a) MFAP4 was downregulated in the sera of HCC patients compared with healthy people (P < 0.05); MFAP4 was downregulated in the sera of cirrhosis patients compared with healthy people (P < 0.05); there was no significant difference in MFAP4 expression between cirrhosis and HCC patients (P > 0.05). (b) MFAP4 could be a potential diagnostic marker to distinguish between healthy people and HCC patients (P < 0.05), the AUC of the ROC was 0.860. (c) MFAP4 could be a potential diagnostic marker to distinguish between healthy people and cirrhosis patients (P < 0.05), the AUC of the ROC was 0.846. (d) MFAP4 could be a potential diagnostic marker to distinguish between cirrhosis patients and HCC patients (P < 0.05), the AUC of the ROC was 0.729MFAP4 was an important tumor suppressor of HCC Bel-7402 cells
Since MFAP4 was downregulated in HCC, we upregulated its expression in Bel-7402 cells to explore its function. MFAP4 overexpression and negative control plasmids were transfected into Bel-7402 cells, respectively. The transfection efficiency was validated by WB analysis after 48 h plasmid transfection and found that these plasmids could effectively upregulate MFAP4 expression in Bel-7402 cells [Figure 3]a. The CCK-8 assay showed that upregulating MFAP4 in Bel-7402 cells inhibited cell proliferation [Figure 3]b. Flow cytometry demonstrated that upregulating MFAP4 induced S phase arrest [Figure 3]c and promoted apoptosis [Figure 3]d. Cell migration and invasion experiments indicated that upregulating MFAP4 could weaken both the ability of migration and invasion of Bel-7402 cells [Figure 3]e.
Figure 3: MFAP4 was an important tumor suppressor of HCC in Bel-7402 cells. (a) MFAP4 was significantly unregulated after plasmid transfection in Bel-7402 cells. (b) Bel-7402-MFAP4 cell proliferation was inhibited compared with Bel-7402-NC (P < 0.05). (c) MFAP4 upregulation of S phase arrest induction in Bel-7402-MFAP4 compared with Bel-7402-NC (P < 0.05). (d) MFAP4 upregulation promoted apoptosis in Bel-7402-MFAP4 compared with Bel-7402-NC (P < 0.05). (e) MFAP4 upregulation could decrease Bel-7402 cell's ability of migration and invasion. (f) MFAP4 upregulation in Bel-7402 cells increased CDK6, CDK4, pRB, BCL-XS, and P27 expression. (g) MFAP4 was significantly unregulated after recombinant lentivirus transfection in Bel-7402 cells. (h) Subcutaneous tumors of nude mice injected with Bel-7402-MFAP4 cells smaller than those injected with Bel-7402-NC cells (P < 0.05)Next, we investigated how MFAP4 could change Bel-7402 cell function. The results showed that MFAP4 upregulation in Bel-7402 cells increased CDK6, CDK4, pRB, BCL-XS, and P27 expression [Figure 3]f.
Recombinant lentiviruses were synthesized to produce Bel-7402 cells stably expressing MFAP4 or negative control plasmids. The transfection efficiency was validated by WB [Figure 3]g. The subcutaneous tumors of nude mice injected with Bel-7402-MFAP4 cells were smaller than those injected with Bel-7402-NC cells (P < 0.05) [Figure 3]h.
> Discussion
In this study, we described for the first time the potential for MFAP4 as molecular marker for HCC diagnosis and prognosis. Through immunohistochemistry, we found that the expression of MFAP4 was significant in HCC tissues compared with the paracarcinoma tissues. Patients who had higher MFAP4 expression in the paracarcinoma tissues always had poorer survival. MFAP4 expression was gradually downregulated with HCC progression, but with no statistical difference (P > 0.05). In this study, normal liver tissues (n = 2), liver cirrhosis tissues (n = 14), paired HCC and paracarcinoma tissues (n = 15), and HCC metastasis tissues in other organs (n = 9) were included. The number of samples varies greatly between each group, and further validation was required in more samples.
Since MFAP4 was a secreted protein, its expression was also detected in sera to explore further potential clinical applications of MFAP4. By ELISA, we found that MFAP4 was downregulated in the sera of both HCC and cirrhosis patients compared with healthy people. When the MFAP4 serum concentration was <14.7365 ng/mL, the sensitivity and specificity to distinguish HCC patients from healthy people were 0.967 and 0.738, respectively, which indicated that MFAP4 was a potential diagnostic marker of HCC. Similarly, we found that MFAP4 had the potential to be a diagnostic marker in healthy people and patients with cirrhosis. By further analysis the relationship of clinical features and the expression level of MFAP4 in the sera of HCC patients, we found that the serum concentration of MFAP4 in male HCC patients was significantly higher than that in female HCC patients. In the 80 patients included in the analysis, there were 73 men and 7 women. The number of patients included in the study was small and the number of male and female patients varied greatly: these might lead to the phenomenon. In the future, we need to expand the sample size to identify this phenomenon.
To ensure that MFAP4 could be used as diagnostic marker of HCC, future research on more extensive samples was required. Cell functional tests indicated that MFAP4 was shown to act as a tumor suppressor by inducing S phase arrest, promoting apoptosis, inhibiting proliferation, and restraining migration and invasion of HCC cells. According to these results, we detected some associated proteins that were involved in these processes. We found that MFAP4 overexpression in Bel-7402 cells increased CDK6, CDK4, pRB, BCL-XS, and P27 expression. CDK4 and CDK6 belong to cycling-dependent kinase (CDK) complexes and promote G1 to G1/S phase conversion via retinoblastoma tumor suppressor protein (RB) phosphorylation.[7],[8] RB has been reported to be a key negative regulator of the G1/S phase transition by interacting with and repressing E2F transcription factors.[9],[10] When RB is phosphorylated by CDK, it becomes inactive rather than promote the transition.[11] P27 is an important tumor suppressor gene;[11] its high expression can not only induce cell cycle arrest, but also promote apoptosis. In breast cancer, p27 upregulation inhibits cell invasion.[11] Bcl-XS expression also changed in the present study. The BCL2L1 gene encodes both human proteins Bcl-XL and Bcl-XS through alternative splicing. The longer isoform (Bcl-XL) acts as an apoptotic inhibitor and the shorter (Bcl-XS) as an apoptotic activator.[12] Bcl-XS expression increased with MFAP4 overexpression, promoting its apoptotic activating function. Based on these results above, we inferred that MFAP4 might regulate the CDK4/6-p-Rb signaling pathway. In the future, we will conduct furtjer research to verify this mechanism.
> Conclusion
MFAP4 expression was significantly lower in both HCC tissues and the sera of HCC patients. MFAP4 could be a potential molecular marker for both HCC diagnosis and prognosis. MFAP4 might play a tumor-suppressor function in HCC cells via CDK4/6-p-Rb signaling pathway. However, these results are preliminary and require further verification; the mechanism of action of MFAP4 in HCC also needs further validation.
Ethics approval and consent to participate
The animal experiments were performed in accordance with The Guide for the Care and Use of Laboratory Animals at Zhejiang University.
All procedures performed in studies involving human participants were in accordance with the Ethical Committee at the First Affiliated Hospital, College of Medicine, Zhejiang University and each patient provided written informed consent. All procedures performed in studies involving human participants were also in accordance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.
Consent for publication
I have obtained consent to publish from the participant to report individual patient data.
Availability of data and material
All data are fully available without restriction.
Acknowledgements
Thank you to all the authors who participated in this article. Xiao Xu and Shusen Zheng conceived and designed the study. Jie Li, Jianguo Wang, Zhikun Liu, Haijun Guo, Xuyong Wei and Qiang Wei performed the experiments. Jie Li and Jianguo Wang wrote the paper. Xiao Xu and Shusen Zheng reviewed and edited the manuscript. All authors read and approved the manuscript.
Financial support and sponsorship
This work was supported by Zhejiang medical and health science and technology project (2022RC055), Natural Science Foundation of Zhejiang province (No. LY22H160046 & LZ22H180003).
Conflicts of interest
There are no conflicts of interest.
> References













Comments (0)