SGLT2 inhibitor downregulates ANGPTL4 to mitigate pathological aging of cardiomyocytes induced by type 2 diabetes

Mouse model of DCM and drug administration

Male C57BL/6J mice (6-8weeks old, 22 ± 2 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. After one week of acclimatization under specific pathogen-free (SPF) laboratory conditions, the mice were randomly grouped. The diet of the modeling group was switched to a 60% high-fat diet (HFD). After 12weeks, the mice in the model group received a single intraperitoneal injection of Streptozotocin (STZ) at a dose of 50 mg/kg. Five days post-STZ induction, tail vein blood from each group of mice was collected to measure fasting blood glucose levels. Mice with fasting blood glucose levels above 16.7mmol/L for three consecutive days were considered successfully modeled. After successful modeling, Empagliflozin (EMPA) was administered via gavage at a dose of 10 mg/kg/day, given between 9 and 10 AM, for a total of 10 weeks [19,20,21]. Two weeks after the end of the drug administration, changes in cardiac function in each group of mice were detected using a small animal ultrasound imaging system.

Cell culture

The AC16 human cardiomyocyte cell line. According to the manufacturer’s instructions, mycoplasma contamination of this cell line was tested and identified as negative. Cells were cultured in DMEM medium (purchased from Corning Inc., USA) containing 12.5% fetal bovine serum (FBS) (purchased from Corning Inc., USA), and 1% antibiotic penicillin-streptomycin (purchased from Gibco, USA). The cell line was maintained at 37 °C and 5% carbon dioxide in an incubator. Cells were grown between passages 5 to 7, and experiments were repeated three times. AC16 cells were exposed to 33.3mmol/L D-glucose and treated with 0.5µM EMPA (purchased from MCE Company, USA). Cells exposed to normal glucose (NG) concentration (4.5mmol/L) were considered the control group and were cultured for 48 h.

Heart tissue and AC16 cells stainingHE staining

Left ventricular tissue from mice was fixed, paraffin-embedded, sectioned, deparaffinized, and hydrated. Sections were then stained with hematoxylin solution, rinsed, differentiated, and subsequently stained with eosin solution, followed by dehydration, clearing, and the tissue sections were visualized and photographed using a StrataFAXS P-S automated slide scanning system (TissueGnostics, Austria).

Masson’s trichrome staining

Sections of left ventricular tissue were deparaffinized and stained with Weigert’s iron hematoxylin, differentiated with acidic ethanol, and then rinsed. The sections were immediately blued with Masson’s blue solution, rinsed, and stained with fuchsin-acidic solution followed by washing with weak acid and phosphomolybdic acid solution. After staining with aniline blue and washing with weak acid solution, the sections were dehydrated with ethanol, cleared with xylene, and the tissue sections were visualized and photographed using a StrataFAXS P-S automated slide scanning system (TissueGnostics, Austria).

γ-H2AX immunofluorescence staining

Sections of left ventricular tissue and AC16 cells were deparaffinized and hydrated. According to the instructions of the kit (purchased from Beyond Biotechnology Co., Ltd., China), non-specific antigen sites were blocked with serum working solution; specific primary antibodies and fluorescent secondary antibodies were incubated, and after incubation in the dark, the cells were stained with nuclear staining solution (DAPI) at room temperature. After cleaning the liquid around the tissue, an appropriate amount of anti-fluorescence quenching solution was added for mounting, and the samples were observed and photographed using a full-spectrum fluorescence lifetime confocal imaging system (Leica Microsystems, Germany).

Cellular senescence β-Gal staining

AC16 cells were fixed with β-Gal staining fixative at room temperature after growth on slides. After washing off the fixative, staining solution was prepared according to the instructions of the kit (purchased from Beyond Biotechnology Co., Ltd., China), and the cells were incubated overnight at 37 °C. The stained cells were observed and counted under a standard optical microscope (Leica Microsystems, Germany).

ELISA method for detecting SASP levels in myocardial tissue of mice

An appropriate amount of myocardial tissue was homogenized in physiological saline using an ultrasonic homogenizer. The homogenate was centrifuged at 4 °C and 4000 g for 15 min, and the supernatant was collected. The levels of senescence-associated secretory phenotype (SASP) factors, include interleukin-1β (IL-1β) and interleukin-6 (IL-6), were determined by measuring the absorbance (A) at 450 nm using an ELISA kit (purchased from Hangzhou Union Biotechnology Co., Ltd.), and the levels were calculated based on the A value and the standard curve.

Protein extraction and western blotting

An appropriate amount of myocardial tissue and cell protein lysate was added to RIPA lysis buffer, sonicated to promote lysis, and centrifuged at 4 °C and 12,000 g for 20 min. The supernatant was collected, and protein content was measured using a BCA assay kit. Thirty micrograms of protein were added to 5×loading buffer and heated in a metal bath for 10 min. Proteins were separated by 12% SDS-PAGE electrophoresis and transferred onto PVDF membranes using wet transfer methods. The membranes were blocked with 5% skim milk at room temperature for 1.5 h, washed three times with TBST, and then incubated with primary antibodies against P53 (1∶1000), P21 (1∶1000), ANGPTL4 (1∶1000) and ACTIN (1∶5000) overnight at 4 °C. After four washes with TBST, HRP-conjugated goat anti-rabbit IgG secondary antibodies (1∶5000) and anti-mouse IgG secondary antibodies (1∶5000) were added and incubated at room temperature for 1 h. The membranes were washed three times with TBST, developed with ECL reagent, and visualized using a highly sensitive multifunctional imaging system. Densitometry analysis was performed using Image J software.

RNA extraction and quantitative real-time PCR

Total RNA was isolated and purified using phenol and chloroform. cDNA was synthesized from 1 µg of total RNA using the QuantiTect Reverse Transcription Kit (TOYOBO Corporation, Japan). DNA amplification reactions were conducted using a PCR amplification kit (PerfectStart® Green qPCR SuperMix).

Primer sequences:

ANGPTL4 (Human): forward 5′–3′ATGGAGGCTGGACAGTAATTCAG.

reverse 5′–3′GCTATGCACCTTCTCCAGACC;

ANGPTL4 (Mouse): forward 5′–3′CCCAGCAGCAGAGATACCTATC.

reverse 5′–3′GGTCATCTTGGGAAGCCTCTTTC;

FOXO1 (Human): forward 5′–3′TTGCCCAACCAAAGCTTCCC.

reverse 5′–3′TTGCTGCCAAGTCTGACGAAA;

FOXO1 (Mouse): forward 5′–3′CTTCCCACACAGTGTCAAGACTA.

reverse 5′–3′GCCAAGTCTGAGGAAAGGAGAAA;

For each amplification cycle, a threshold cycle (Ct) value was obtained, and the ΔCt, which is the difference in Ct values between the target mRNA and the housekeeping gene mRNA (β-Actin), was calculated. The fold increase in mRNA expression relative to the control group was determined using the 2 − ΔΔCt method. Bar graphs reported the genes from three independent experiments, with the control group set to a value of 1.

Transfection with siRNA and overexpression plasmids

siRNA plasmids for interference were designed and synthesized by Beijing Qingke Biotechnology Co., Ltd., while overexpression plasmids were extracted and purified by Shandong Wei Zhen Biotechnology Co., Ltd. When the density of AC16 cells reached 60-80%, transfection was carried out. After preparing the transfection solution, Opti-MEM serum-free medium was used for transfection. The medium containing the transfection solution was removed after 8 h, and replaced with complete growth medium. After a 48 h incubation, the cells were treated with high glucose and PA, followed by detection of mRNA and protein levels.

Chromatin immunoprecipitation followed by quantitative real-time PCR (ChIP-qPCR)

ChIP chromatin was prepared using the truChIP Chromatin Shearing Kit (Covaris, USA). AC16 cells were cross-linked with freshly prepared 11.1% formaldehyde for 10 min, and primary mouse cardiomyocytes for 5 min, and the cross-linking was stopped at room temperature by adding 300 µl of Quenching Buffer E. Subsequently, according to the kit instructions, the nuclei were prepared and transferred to AFA tubes for sonication in a Covaris sonicator to shear the chromatin, and the shearing efficiency of different cells was detected by DNA electrophoresis and Western blotting. The sheared chromatin was diluted at a ratio of 1:1 with Covaris 2X IP Dilution Buffer (10 µl 2X IP Dilution Buffer + 20 µl 5X PIC), centrifuged, and the supernatant was taken for downstream IP detection. The SimpleChIP® Plus Sonication ChIP Kit 4 C and RT Reagents kit from CST was used for the ChIP assay. Diluted chromatin samples (500 µl) were incubated with 10 µl of FOXO1 antibody overnight at 4 °C with shaking. The next day, magnetic beads were added and incubated at 4 °C with shaking, followed by washing, and each IP sample was eluted with 1X ChIP elution buffer at 65 °C for 30 min with shaking. The cross-linking was reversed, and DNA was purified using a centrifugal column. The ChIP experiment was analyzed by qPCR using specific primers. The recovery of ChIP and DNA was calculated as IP/Input%.

Sequence:

ANGPTL4-FOXO1 (Human): forward 5′–3′gcc tca ctc agt act tcc ttt gtc.

reverse 5′–3′aag ttc tca ggc agg tgg aga tac;

ANGPTL4-FOXO1 (Mouse): forward 5′–3′tga caa ggt ctt ctt cct gga tgg.

reverse 5′–3′gaa gca att gga gga agc tct gtg;

Bioinformatics analysis

R software (version 4.2.1) was utilized for the normalization and probe annotation of RNA-seq data. Differential expression analysis was conducted using the “limma” package in R, and the results were visualized using volcano plots and heatmaps generated by the “ggplot2” and “pheatmap” packages, respectively. Genes with a fold change (FC) greater than 2 in log2 scale and a p-value less than 0.05 were considered differentially expressed genes (DEGs). The log2 (FC) values were used to perform Gene Set Enrichment Analysis (GSEA) with the “clusterprofiler” package, and pathways with a normalized enrichment score (NES) greater than 2, a false discovery rate (FDR) less than 0.25, and a p-value less than 0.05 were selected. Additionally, reactome pathway enrichment analysis was performed on the DEGs to assess their functions, locations, or pathways, and the results were visualized using bubble charts. Finally, an intersection with the DEGs and the CellAge database was conducted, and a Venn diagram was created using the online tool at http://bioinformatics.psb.ugent.be/webtools/Venn/ to visualize the overlap.

Data analysis

Experimental data were statistically analyzed and graphed using GraphPad Prism software version 8.0. Comparisons between two samples were performed using the two-sample independent t-test, while multiple group data were assessed using one-way analysis of variance (ANOVA). A p-value less than 0.05 was considered to indicate statistical significance.

Comments (0)

No login
gif