Lewis rats were purchased from Beijing Vital River Laboratory Animal Technology Co., LTD. All rats were maintained in a specific pathogen-free (SPF) comfortable environment at a temperature of 25 °C ± 1 °C with free access to water and food. Sixty-eight rats aged 6–8 weeks were used in the present experiment. After adapting to the environment for one week, the rats were randomly divided into four experimental groups: a normal control group (NC), an EAU group (EAU), a 5 μl of shRNA-RBPJ lentivirus (sequence: GCAAGCGGATAAAGGTCATCT) injection group (RBPJKD 5 μl), and a 10 μl of shRNA-RBPJ lentivirus injection group (RBPJKD 10 μl). Refer to the previous EAU induction method [19, 20], the EAU rats were induced by IRBP emulsion as follows: IRBP (0.02 mg) was diluted in 1.5 ml of sterile phosphate buffer, and then blended with TB (0.02 mg) and CFA. To induce EAU, approximately 200 μl of IRBP emulsion was injected subcutaneously into the lower abdomen, posterior neck, and soles of each rat. After the EAU induction, the rats in the shRNA-RBPJ lentivirus groups were injected 5 μl and 10 μl of shRNA-RBPJ lentivirus in the vitreous cavity, respectively. The study protocol and experimental design were approved by the Laboratory Animal Management Committee of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (AWE-2022-017). All procedures involving experimental animals were performed according to the ARVO guidelines for the use of animals in ophthalmic and vision research.
Construction of shRNA-RBPJ LentivirusTo produce shRNA-RBPJ-carrying lentivirus, the plasmid containing pri-miRNA sequences was synthesized, and then connected to the enzyme cleaved vector through the enzyme cleavage sites (Restriction enzyme Bsal for two cleavage sites) at both ends. Subsequently, the connecting product was transferred into the prepared bacterial receptive cells, followed by selection of the grown monoclonal colonies for sequencing identification to validate the correct target gene sequence. Finally, the shRNA-RBPJ-carrying plasmid vectors were transfected into lentivirus.
Hematoxylin-Eosin StainingOn day 12 after treatments with shRNA-Rbpj lentivirus, the eye tissues of the rats were isolated and fixed in 4% paraformaldehyde solution for 24 h. After dehydration by ethanol, embedded in paraffin, the tissue sections were stained with H&E solution, and histopathological observation was performed under an optical microscope (55i, Nikon, Japan). The clinical inflammation and pathology were scored and graded according to the previous criteria [21], and the inflammatory degree of the eye was evaluated and scored on a scale of 0–4 in half-point increments according to a semi-quantitative system.
Real-time Quantitative PCRAfter different treatments for 12 days, the eye tissues in each group were isolated and ground under liquid nitrogen. Subsequently, total RNAs in tissues were collected using the RNA extraction kit (Sparkjade, Jinan, China) and reverse transcribed using HiScript II Reverse Transcriptase (Vazyme, Nanjing, China). The relative expression of Notch1, Jagged1, Hes1, and Arg-1 genes in each group was amplified using SYBR Green I in 96-well plates (NEST Biotech., Wuxi, China), and GAPDH was used as the internal reference. The quantification was calculated by the 2−ΔΔCT method. The primer sequence is shown in Table 1, and the experiment was repeated three times.
Table 1 sequences of the target genesWestern BlotThe eye tissues were lysed with RIPA lysis buffer and then sonicated on the ice for 10 min, followed by centrifugation at 5000 g at 4 °C for 10 min (NEST Biotech., Wuxi, China). After quantification with an enhanced BCA protein assay kit (Sparkjade, Jinan, China), the lysate was denatured in a 100 °C water bath for 10 min, followed by separation by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). After that, the proteins on the SDS-PAGE membrane were then transferred to a poly (vinylidene fluoride) (PVDF) membrane using a wet transfer, then blocked with 5% bovine serum albumin (BSA) for 1 h. Subsequently, the membrane was incubated with RBPJ primary antibody (Bioss, Beijing) overnight at 4 °C, and washed with TBST four times, followed by incubation with HRP-conjugated secondary antibody at 4 °C for 1 h. The membrane was washed with TBST four times again, followed by washing with TBS twice. After that, the chemiluminescence enhancement (ELC) kit (Novozan, Nanjing) was used for visual detection, and Image J 1.8.0 software was used for gray value detection and analysis.
Enzyme-linked Immunosorbent AssayThree rats in each group were sacrificed in a sterile environment on days 6, 12, and 18 after EAU induction, and then the spleen, lymph node, and eye tissues were collected at the same time. RIPA lysate (Sparkjade, Jinan, China) was used to extract tissue proteins. The relative expression levels of IL-1β and IL-4 were determined by commercial ELISA kits (Jianglai Biotech., Shanghai, China). The detection limits for IL-1β and IL-4 were 1.51 pg/mL and 0.91 pg/mL, respectively. The experiments were repeated three times, and significant difference analysis was further performed.
Flow CytometryDetection of the Dynamic Changes of M1 and M2 Macrophages in Tissues by Flow CytometryThree rats in each group were executed on days 6, 12, and 18, respectively, and spleen, lymph nodes, and eye tissues were then collected and immersed in RPMI-1640 medium. The tissues in each group were transferred to a 200-mesh cell sieve, and then mechanically ground, followed by the collection of mononuclear cell suspensions in 15 ml plastic tubes after rinsing the cell sieve with RPMI-1640 medium. The precipitated cells were obtained by centrifugation, and the monocytes were isolated with a rat monocyte extraction kit (Solarbio, Beijing, China). After being cultured at 37 °C for 4 h, adherent cells were obtained by trypsin digestion, followed by staining with FITC-F4/80 antibody (Bioss, Beijing, China) for 30 min on ice. After treatment with intracellular fixation permeabilization buffer for 1 h, cells were washed gently and stained with PE-CD206 (Bioss, Beijing, China) or PE-CE86 (eBioscience, USA) antibodies for 50 min on ice. Subsequently, cells were washed and resuspended in PBS, and then the M1 and M2 macrophage polarization levels were measured by flow cytometry (Agilent Novocyte, CA, USA), and M1/M2 ratio changes were analyzed.
Detection of the Change in mtROS Level in Macrophages by Flow CytometryAfter 12 days of EAU induction, 3 rats in each group were anesthetized, and the eye tissues were collected to obtain macrophages according to the above method. Next, macrophages were washed with pre-warmed HBSS buffer, and then incubated in a monocyte culture medium containing 5 μM of MitoSOX (Abcolonal, China) probes at 37 °C for 30 min in an incubator. Subsequently, macrophages were washed with HBSS buffer, centrifuged at 500 g for 6 min, and then the supernatant was discarded to remove the medium and extracellular dyes. After repeating this step three times, fluorescence intensity was analyzed using flow cytometry with an FITC fluorescence channel.
Double Immunofluorescence StainingAfter 12 days of EAU induction, the rats were sacrificed with an overdose of 5% phenobarbital in a sterile environment. At the same time, the eye tissue was collected, fixed with 4% paraformaldehyde, and dehydrated and paraffin sectioned. After antigen repair and blocking, the first primary antibody CD68 (1:100, ABclonal, China), was incubated overnight at 4 °C. On the second day, the corresponding HRP secondary antibody was added and incubated at room temperature for 50 min. The slides were washed with PBS and then dripped with TSA dye and incubated at room temperature for 10 min in the dark. After microwave treatment, the second primary antibodies Notch1 (1:100, Abcolonal, China), Jagged1 (1:100, Bioss, China), and Hes1 (1:100, Bioss, China) were added and incubated overnight at 4 °C. Add the corresponding second antibody, incubate for 50 min at room temperature in the dark, and repeat step 5. After the slides were slightly dried, DAPI staining solution was added dropwise in the circle and incubated at room temperature in the dark for 10 min. Observe and collect images under a fluorescence microscope.
Transmission Electron MicroscopyAfter 12 days of EAU induction, the eyeballs of the rats were taken out, placed in an electron microscope fixative, and then fixed with osmic acid prepared with 0.1 M phosphate buffer saline (PBS, pH = 7.4) at room temperature in the dark for 2 h. The slices were dehydrated and embedded in epoxy resin. Next, ultrathin sections were stained with 2% uranyl acetate saturated alcohol and 2.6% lead citrate solution for 8 min, respectively. Finally, the transmission electron microscope (TEM, Hitachi, Japan) was used to observe and collect pictures for analysis.
ImmunohistochemistryTo further confirm the effect of mtROS on M2 macrophage polarization, EAU rats injected with different doses of RBPJ silencing lentivirus were intraperitoneally injected with 200 mg/kg N-acetyl-L-cysteine (NAC) daily to remove mtROS in vivo, and the injection dose was referred to the previous literature [21]. The expression of Arg-1 was detected by immunohistochemistry at the protein level. After 12 days of EAU induction, the eye tissues of the rats in each group were fixed and sectioned for dewaxing. After antigen repair, 3% hydrogen peroxide solution was added and incubated at room temperature for 25 min in the dark, then blocked with 3% BSA at room temperature for 30 min. Next, diluted Arg-1 (1:500, proteintech, China) antibody was added and incubated overnight at 4 °C. Further, HRP-labeled secondary antibody was added and incubated at room temperature for 50 min, followed by adding freshly prepared DAB chromogenic solution. After dehydration and transparency, the slices were sealed with sealing glue. The results were interpreted under a white light microscope.
Comments (0)