Abstract
Introduction: Lavandula angustifolia L. (Lamiaceae family) displays notable cytotoxic properties against bacteria and fungi, as well as antioxidant activity. Recently, drug delivery systems for cancer therapy have focused on novel carrier designs that demonstrate high efficiency and reduced side effects. The encapsulation and delivery of bioactive agents through essential oils has emerged as a new strategy in cancer research. This study aimed to investigate the effects of nanoparticles synthesized using L. angustifolia essential oil on MCF-7 and SK-BR-3 breast cancer cell lines.
Methods: Physical and chemical parameters—specifically, particle size, zeta potential, and polydispersity index—were optimized using various techniques. Chemical composition analyses via GC/MS identified thirteen components in the essential oil. Eucalyptol, (+)-2-Bornanone, and endo-Borneol were the major fractions, while acetic acid and p-Cymen-7-ol appeared in smaller amounts. Zeta potential measurements revealed the electrical charge on particle surfaces, and FTIR analysis displayed distinct peaks corresponding to functional groups. Cell viability was assessed via MTT assay to evaluate nanoparticle toxicity against MCF-7 and SK-BR-3 cells.
Results: The synthesized nanoliposome showed notable cytotoxic effects on MCF-7 and SK-BR-3 cells, with IC50 values of 305 ± 0.29 and 400 ± 0.39 µg/ml, respectively. Expression of the caspase-3 gene increased approximately 2-fold in both treated cell lines at 48 hours after treatment, while Bcl2 expression decreased. The control group showed the lowest level of caspase-3 expression.
Conclusion: These findings suggest that nanoparticles synthesized from L. angustifolia essential oil, particularly those enriched with Eucalyptol and Bornanone, can enhance the precision of chemotherapeutic targeting in breast cancer. This nanoliposome formulation could be a promising novel candidate for pharmaceutical applications and improved cancer therapies.
Different types of cancer, accounting for approximately 17% of global mortality, cause serious financial, emotional, and physical challenges in all communities. Breast cancer, defined as unregulated cell growth, is the most prevalent cancer, especially in mature women in many Asian countries1, 2. In Iran, the high incidence and mortality rates of breast cancer have risen as a major public health concern3. Currently, the use of synthetic and chemical anticancer drugs has shown various side effects, including diarrhea, constipation, indigestion, extreme fatigue, and compromised immune function4. Therefore, due to convenient access to natural products, their higher efficacy, fewer adverse effects, and diverse chemical composition, the use of medicinal plants in cancer therapy has gained more attention5.
The application of nanomaterials as a highly efficient method for drug delivery in cancer treatment has recently attracted significant interest. Therefore, the use of a drug delivery system based on medicinal plants aims to ultimately reduce the hazardous effects caused by conventional cancer therapy methods, such as surgery, radiotherapy, and chemotherapy. To overcome these obstacles, numerous researchers have been interested in applying nanotechnology research to the treatment of breast cancer6. To date, the anticancer effects of nanoparticles derived from various medicinal plants have been investigated in several studies7, 8, 9, but the mechanism of cell growth and inhibition has received less attention and has been the subject of only a few studies.
Lavandula angustifolia Mill., from the Lamiaceae family, is one of the most important medicinal herbs in the Mediterranean region. This genus and its related species have been applied as spasmolytic, carminative, stomachic, or diuretic10. The L. angustifolia essential oil also possesses many biological activities, including anticancer and antioxidant effects, as well as the ability to scavenge free radicals and stimulate the immune system11, 12. The Caspase cascade genes, including both upstream and downstream genes, play a crucial role as key mediators of this event. Caspase proteins cleave their substrates by targeting the carboxyl side of the aspartate residue13. BCL2 gene positivity is observed in 20% of breast cancer patients, and the BCL2 gene is notably overexpressed in these receptors. SK-BR-3 is a HER2-positive human breast cancer cell line that can exhibit an epithelial morphology in tissue culture14.
In cancer therapy, resistance to drugs and chemical treatment is a primary challenge. Therefore, the development of novel therapeutic agents to overcome treatment resistance is vital and important. This study aimed to investigate the cellular and molecular changes in MCF-7 and SKBR-3 cell lines treated with the nanoparticle of L. angustifolia essential oil.
Methods Extraction of Lavender Essential Oils (LEO)The dried tissues of Lavandula angustifolia Mill. were crushed using an electric mill before being dissolved in a 1:10 (w/v) solution of 80% ethanol and distilled water. The solutions were shaken over the course of one day. Distilled water was stirred for one day at 25 °C using a magnetic stirrer. The mixture was then filtered through filter paper. After freeze-drying to obtain a liquid extract, the extracts were concentrated using a vacuum evaporator (Heidolphe, Germany). For further use, the essential oil was extracted and stored at 4 °C6.
Gas Chromatography-Mass SpectrometryBioactive natural compounds of lavender essential oil were determined using Gas Chromatography-Mass Spectrometry (Agilent Technologies, Palo Alto, CA, USA). An HP–5MS 5% column coated with methyl silicone served as the stationary phase, and helium was used as the carrier gas at a constant flow rate of 10 mL/min15.
Encapsulation Process and NanoliposomesCholesterol, polyethylene glycol (PEG), and soybean phosphatidylcholine (SPC) (70:31:1) were used to construct nanoliposomes in chloroform solvent. The solution was then combined with lavender essential oil dissolved in ethanol. A rotary evaporator was used at 34 °C under reduced pressure to vaporize the solvent, forming liposomes. An ultrasonic process at 60 °C for 10 min in a water bath was applied to the suspensions of lavender nanoparticles. Morphological and structural characterization of the constructed liposome formulation was investigated using an atomic force microscopy instrument14. Dynamic Light Scattering (DLS) was employed to determine the average particle size of LEO-loaded liposomes at room temperature. To estimate the drug release rate, approximately 100 mL of the LEO-encapsulated liposomal sample was placed in a dialysis bag (molecular weight cut-off 12 kDa). The bag was immersed in 100 mL of PBS (pH 7.4) at 37 °C with gentle, consistent agitation at 100 rpm on a rotary apparatus and incubated for 72 h at 37 °C. At different time intervals, 1 mL of the release medium was removed for UV spectrophotometric assay at a wavelength of 270 nm15.
Fourier Transform Infrared Spectroscopy (FT-IR)FT-IR spectroscopy of L. angustifolia essential oil before and after encapsulation was investigated using a VIR-100/200/300 (Jasco, France) spectrometer. The absorption FT-IR spectra of the particles and extract were observed in the range of 400–4000 cm−1 at room temperature16.
Cell Lines and Cell CultureMCF7 (Cat N. IF.Y10021) and SKBR-3 (Cat N. IF.Y.WC10022) cell lines were obtained from the Infertility Research Center at the University of Shahid Sadoughi Medical Sciences in Iran. The cell lines were cultured in RPMI (Gibco). The culture medium was supplemented with 10% (v/v) fetal bovine serum (Sinaclon, Iran), 5% fetal bovine serum, and penicillin-streptomycin (100 U/mL). The cells were then incubated at 37 °C with 5% CO2.
Cell Viability and Toxicity AssaysThe cytotoxic effect of lavender essential oil and LEO nanoparticles on two cell lines, MCF7 and SKBR3, was studied using the MTT assay method. One hundred trypsinized cells were seeded into 96-well microplates at a concentration of 10⁴ cells/mL per well, containing 100 μL of complete culture medium. They were then incubated for 24 h at 37 °C with 5% CO2 and humidified air, and were regularly monitored using an inverted microscope. The cells were treated for 24 h, 48 h, and 72 h with different concentrations of lavender essential oil and LEO-nanoparticles, ranging from 5 to 100 μg/mL, dissolved in an appropriate solvent. The cytotoxic effect was measured by adding 100 μL of culture medium containing MTT formazan (5 mg/mL) and incubating for 4 h at 37 °C. The produced formazan crystals were dissolved using 10% DMSO solution, and the absorbance at the three time points was recorded on an ELISA plate reader (Drawell Dnm-9602, China) at 570 nm9. Non-treated cells in culture medium served as a control group. The percentage of cell survival (cell viability = OD average value of treatment group / OD average value of the control group) was calculated by comparing the optical density (OD) to the control group.
The trypan blue dye exclusion technique was also used to determine the percentage of viable cells in suspension treated with lavender essential oil nanoparticles. Here, 50 μL of the cell suspension was mixed with an equal volume of trypan blue. A hemocytometer slide was used to count the transparent (live) cells, while dead cells appeared blue17.
RNA Extraction, cDNA Synthesis, and qRT-PCRCells treated with the IC50 dose of the synthesized LEO-nanoparticle and cells treated with lavender essential oil were subjected to RNA extraction. The targeted cells were washed with PBS (Sinaclon, Iran) and lysed directly in the culture flask prior to RNA isolation. Total RNA was isolated using RNX-Plus (Sinaclon, Bioscience, Iran) following the manufacturer’s instructions. The quantity and quality of the extracted RNA were determined using a NanoDrop 2000 Spectrophotometer and 1.5% agarose gel electrophoresis. Superscript II reverse transcriptase (Qiagen, Invitrogen) was used for first-strand cDNA synthesis. Real-time PCR amplification was performed on an ABI PRISM 7700 Sequence Detection System (Thermo Scientific, Waltham, MA, USA) using 96-well plates. Real-time PCR was carried out in a total volume of 20 μL containing 0.5 μL of synthesized cDNA from each sample, 1× buffer (10X), 5 mM MgCl₂, 200 μM dNTPs, 300–600 nM of each primer, 0.2 U/μL enzyme, and SYBR Green I. A solution buffer containing ROX dye served as a passive reference to normalize fluorescence in real-time PCR. PCR amplification was performed in triplicate, using a thermocycler program of 95 °C for 10 min for DNA denaturation, followed by 35–45 cycles of 95 °C for 20 s and 60 °C for 1 min. At the end of each PCR assay, the melting curve was analyzed to verify primer specificity, yielding a single melting peak for the amplified product. The real-time amplification was done with the same sample concentrations (equal dilution), using primers for the housekeeping gene (GAPDH) and the target genes to measure relative efficiency.
Table 1.
The characteristics of primers used in Real-time quantitative PCR primers
Gene Name Gene ID Amplicon size(bp)/ Concentration (nm) Cytogenetic Location Primer Sequence HER-2 NM_001005862.2 131 17q12 F (5'- CCTCTGACGTCCATCATCTC -3') 300 R (5'- ATCTTCTCGTGCCGTCGCTT -3') CASP3 NM_001354777.1 241 4q35.1 F (5'- AAGCGAATCAATGGACTCTGG -3') 420 R (5'- CTGTACCAGACCGAGATGTC -3') GAPDH NM_001256799.3 195 12p13.31 F (5'- CCATGAGAAGTATGACAAC -3') 500 R (5'- GAGTCCTTCCACGATACC -3') Statistical AnalysisEach in vitro experiment was repeated at least three times to verify reproducibility. The SPSS program was used to analyze the data obtained. All results were expressed as the mean and standard deviation of the mean (SD). A Student’s t‑test or one-way ANOVA was performed to compare the means between two independent groups. All graphs were designed using GraphPad Prism® 5 software (version 5.04). *P
Table 2.
Major components of Lavandula angustifol oils separated by Gas Chromato-graphy-Mass spectroscopy
Compound Composition (%) Acetic acid, 1,7,7-trimethyl-bicyclo[2,2,1]hept-2-yl ester 0.15 p-Cymen-7-ol 0.24 2-Cyclohexen-1-ol, 2-methyl-5-(1-methylethenyl)-, cis 0.25 β-Pinene 0.43 Bicyclo[3,1,1]hept-2-ene-carboxaldehyde,6,6-dimethyl- 0.44 Camphene 0.65 α-Pinene 1.41 Cyclohexene, 1-methyl-4-(1-methylethyl)- 1.74 Terpinen-4-ol 1.43 o-Cymene 1.47 endo-Borneol 29.2 (+)-2-Bornanone 30.5 Eucalyptol (1,8-Cineole) 30.74
Comments (0)