Monosodium iodoacetate (MIA) was obtained from Sigma-Aldrich, Inc. (MO, USA) while metformin and pravastatin, were obtained from CID Co. (Cairo, Egypt) and HI PHARM (Cairo, Egypt), respectively. Both drugs were supplied in a powder form and normal saline was used as a solvent. Thiopental used for anesthesia was supplied by EIPICO (Tenth of Ramadan City, Egypt).
Establishment of a rat OA modelThe Institutional Animal Care and Use Committee of Cairo University (Permit number: PT3026) accepted the study, which followed the Guide for Care and Use of Laboratory Animals provided by the US National Institutes of Health (NIH Publication No. 85-23, revised 2011). In-house bred adult 50 male albino Sprague Dawley rats weighing 150–200 g from the Faculty of Pharmacy, Cairo University animal house were used. Within the animal facility associated with the Faculty of Pharmacy, rats were housed under constant temperature (~ 20–23 °C) and humidity (~ 50%) with a 12h light/dark cycle. They had unrestricted access to water and were given standard rodent chow for food.
They were randomly allocated into five groups each composed of ten rats. After anesthesia with thiopental, the control group received 50 μl of sterile saline via intraarticular injection into the knee joint. The other groups were given 2 mg of MIA in 50-µl normal saline by injection into the intraarticular knee joint space to induce OA. After 14 days of MIA injection, one group served as a positive control group, a second group received metformin 100-mg/kg orally for 14 days (Na et al. 2021), a third group received pravastatin 10-mg/kg/day orally for 14 days (Liang et al. 2022) and a fourth group received both 100 mg/kg of metformin and 10 mg/kg of pravastatin orally for 14 days.
Radiological assessmentAfter anesthesia using ketamine (50 mg/kg)/xylazine (2 mg/kg) mixture, the hind limbs of each rat were straightened by an adhesive tape (Saber et al. 2023). Fisher® X-ray device (Fisher R183, Emerald tube 125) was used for imaging the left stifle joint at the lateromedial and craniocaudal views.
Enzyme-linked immunosorbent assay (ELISA)Serum samples preparation involved allowing samples to clot at room temperature for 20 min before being centrifugated for 10 min at approximately 3000 rpm. The serum samples were then stored for later use at − 80 °C. To thoroughly remove excess blood, ice-cold PBS was used to rinse the tissue collected after being minced into small pieces. Using a glass homogenizer on ice, tissue pieces were homogenized in PBS after being weighed. The homogenates were then centrifuged for 5 min at 5000 × g to get the supernatant. The serum/ tissue homogenate samples or standards were added to the microplate that has been coated with an antibody specific to the protein of interest. Standards or samples, a biotin-conjugated detection antibody and an avidin-horseradish peroxidase (HRP) conjugate were then added sequentially with washing excess away. Next, a substrate solution was added that reacts with the HRP enzyme producing a change in color or light development. At a wavelength of 450 nm ± 10 nm, a microplate reader was used to measure the optical density.
Collagen Type II (COL2) (Cat. # MBS2702065, MyBioSource, Inc., CA, USA), Cartilage oligomeric matrix protein (COMP) (Cat. # MBS267386, MyBioSource, Inc., CA, USA) and C reactive protein (CRP) (Cat. # SCA821Ra, CLOUD-CLONE CORP., TX, USA) were detected in serum samples using ELISA kits as per the instructions of the manufacturer. Thermo Scientific Pierce BCA Protein Assay Kit (Cat. # 23,225 and 23,227, Thermo Fisher Scientific Inc., Massachusetts, USA) was used to detect and quantify total protein colorimetrically. Protein kinase B (AKT1) (Cat. # LS-F49321, LifeSpan BioSciences, Inc., MA, USA), phosphotylinosital 3 kinase (PI3K) (Cat. # MBS260381, MyBioSource, Inc., CA, USA), signal transducer and activator of transcription 3 (STAT3) (Cat. # MBS2515874, MyBioSource, Inc., CA, USA) and interleukin-6 (IL-6) (Cat. # SEA079Ra, CLOUD-CLONE CORP., TX, USA) were detected in tissue homogenates using ELISA kits as per the instructions of the manufacturer.
Quantitative real-time polymerase chain reaction (qRT-PCR)A Total RNA isolation kit (GeneDireX, Inc., Taoyuan City, Taiwan) was used to extract total RNA form the frozen serum samples according to the protocol of the manufacturer. Yield and quality of extracted RNA were assessed using the Qubit™ RNA HS Assay kit (Invitrogen Inc., CA, USA). cDNA was synthesized using 1 µg of total RNA using the SuperScript VILO cDNA synthesis kit (Cat. # 11,754–050, Life Technologies, CA, USA) as per the manufacturer’s instructions. Using three technical replicates, qPCR assay was carried out. Using SYBR green PCR master mix (Qiagen), amplification was done in a total volume 20 μl as follows: 10-μl 2X SYBR mix, 10-ng cDNA and 300 nM of forward and reverse primers for the targets genes (TREM-1) (Forward AGGAAGGCTTGGCAGAGGC and Reverse ACAGGGTCGTTCGGAGGAT). Relative transcript levels of TREM-1 were calculated according to 2-ΔΔct method (Schmittgen and Livak 2008) with β-Actin used as a reference gene (Forward CTATCGGCAATGAGCGGTTCC and Reverse TGTGTTGGCATAGAGGTCTTTACG). We repeated the experiments three times, and the three independent biologic replicates were used to calculate the mean values and standard errors. Using paired student’s t test, the significance of differences between data sets was evaluated.
Colorimetric assayIn tissue homogenates, the oxidative stress markers thiobarbituric acid derivative (TBARS) measured as malondialdehyde (MDA) and non-protein thiols (NPSH) were estimated (Bio-diagnostic, Giza, Egypt). After tissue homogenization and centrifugation, the supernatant was removed for assay and stored on ice. MDA, a lipid peroxidation measurement, was estimated based on its reaction in an acidic medium with thiobarbituric acid at 95℃ for 30 min to produce a resultant pink product, the absorbance of which can be measured at 534 nm. NPSH were estimated based on the reduction of 5,5′ dithiobis (2-nitrobenzoic acid) to form a yellow product whose absorbance, when measured at 405 nm, is directly proportional to NPSH concentration.
Histopathological examinationKnee joints were collected, at the end of the experiment, from each group. Ten% formalin solution and decalcifying solution-lite (Sigma-Aldrich Inc., MO, USA) were used for fixing and decalcifying the tissues, respectively. The tissues were embedded in paraffin. After being cut, xylene was used to dewax 4- to 5-μm thick sections which were dehydrated through an alcohol gradient. Finally, hematoxylin and eosin (H&E) and safranin O were used to stain these sections. Semiquantitative grading was used to score histopathological changes. The grading included five scores as follows: 4, severe synovitis and erosion with loss of normal joint architecture; 3, moderate synovitis and erosion with a change in joint architecture; 2, synovitis with some marginal erosion but with maintained joint architecture; 1, minimal synovitis without cartilage/bone erosion and 0, normal.
Statistical analysisData are presented as means ± SD. GraphPad Prism 9.0.0 software was used to perform statistical analysis. One-way analysis of variance (ANOVA) was used to perform statistical comparisons, and, for all tests, the statistical significance level was set as p < 0.05.
Comments (0)