96 glioma tissues that all be identified by pathologists according to 2016 World Health Organization (WHO) classification criteria from the Department of Pathology of the Affiliated Hospital of Xuzhou Medical University between 2016 and 2017 were collected. The ethical review and approval were obtained from the institutional ethics committee of Affiliated Hospital of Xuzhou Medical University (ethical review no. XYFY2018-KL056-01). RNA sequencing (RNA-seq) data of GBM and low-grade glioma (LGG) tissues (n = 689) from The Cancer Genome Atlas (TCGA) database and normal tissues (n = 1157) from Genotype Tissue Expression (GTEx) database were collected. RNA-seq data of glioma tissues after deletion of incomplete data (batch I: n = 413; batch II: n = 273) from Chinese Glioma Genomes Atlas (CGGA) were also used for the clinical analysis.
Cell cultureThe human GBM cell lines (U118, U87, U251, T98G and LN229), human normal brain glial cells (HEB) were originally obtained from the American Type Culture Collection (ATCC). The cells were cultured in Dulbecco’s modification of Eagle’s medium (DMEM, Keygen Biotech, China) supplemented with 10% fetal bovine serum (FBS, Takara, Japan) at 37 ℃ in a humid atmosphere containing 5% CO2.
Stable knockdown and overexpressed cell lines constructionThe shRNAs targeting SIN1 (shSIN1-#1: GCCCATTCATAAGTTTGGCT; shSIN1-#2: GCTCATCTGCTGGCAGTAT) and the negative scrambled control shRNA (shCTRL: CCTAAGGTTAAGTCGCCCTCG) were constructed into pSLenti-U6-shRNA-CMV-EGFP-F2A-Puro-WPRE vector (OBiO, China). Glioma cell lines U251 and U118 were transduced with these lentiviruses and subsequently selected with puromycin (Sigma, USA) for 2 weeks to achieve stable SIN1 knockdown. The efficiency of the knockdown was assessed using immunoblotting and quantitative real-time PCR.
The coding sequence (CDS) of SIN1 (NM_001006617) was cloned into a PiggyBac Transposon Vector. Glioma cell lines U251 and U118 were transduced with the vector by HighGene transfection reagent (ABclonal, China) and subsequently selected with puromycin (Sigma, USA) for 2 weeks to achieve SIN1 overexpression. The efficiency of SIN1 overexpression was assessed using immunoblotting and quantitative real-time PCR.
Immunohistochemistry (IHC)Glioma tissues were fixed in 4% paraformaldehyde, embedded in paraffin and cut into 4 μm sections. The sections were deparaffinized in xylene and rehydrated in a series of graded ethanol. For antigen retrieval, sections were autoclaved in sodium citrate buffer in a pressure cooker for 3 min. Before blocking, the sections were treated with fresh 3% hydrogen peroxide for 10 min. Then the sections were blocked with 10% normal goat serum for 15 min at room temperature (RT). Next, sections were incubated with specific diluted primary antibody against SIN1 (Proteintech, 15463-1-AP, China) overnight at 4℃, followed by incubation with secondary antibodies for 1 h at room temperature. Thereafter, sections were incubated for 2–5 min at room temperature with freshly prepared diaminobenzidine (DAB) and stained with hematoxylin. Slide images were captured using the Olympus microscopy and independently scored by two experienced pathologists blinded to patients’ characteristics.
Scores were calculated on intensity and percentage of positive staining tumor cell nuclei or cytoplasm in the whole tissue stains, which were evaluated according to Fromowitz Standard. Intensity score was defined as follows: 0, negative; 1, weak; 2, moderate; 3, strong. The percentage of positive cells was evaluated using the following scoring system: 0 for 0% staining; 1 for 1–24% staining; 2 for 25–49% staining; 3 for 50–74% staining; and 4 for 75–100% staining.
Hematoxylin-eosin (H&E) staingThe H&E staining was performed using H&E staining kit (Beyotime, China) according to the manufacturer’s instruction. Briefly, tissue sections were first deparaffinized in xylene for 10 min, followed by rehydration through a series of graded alcohols (100%, 90%, 80% and 70%) and rinsed in distilled water. The sections were then stained with hematoxylin for 8 min, followed by a rinse in tap water. To differentiate the staining, the slides were briefly dipped in acid alcohol slow differentiation slolution (Beyotime, China) for 10 s and rinsed again in tap water for 10 min. After thorough rinsing in tap water, eosin staining was carried out for 1 min. Finally, the sections were dehydrated through graded alcohols (70%, 80%, 90% and 100%), cleared in xylene, and mounted with a coverslip using a resinous mounting medium. All stained sections were observed under a light microscope for histopathological analysis.
Quantitative real-time PCRTotal RNA was extracted from cells with TRIzol (Invitrogen) according to the manufacturer’s instruction. cDNA was synthesized from RNA by reverse transcription using HiScript III RT SuperMix for qPCR (+ gDNA wiper) purchased from Vazyme. Quantitative real-time PCR was carried out on an ABI-7500 using TB Green™ Premix Ex Taq™ (Tli RNaseH Plus) (TAKARA). For qPCR, the designed primers are: SIN1-F, 5’-CCTCTGCAGCTGAATAACCC-3’, SIN1-R, 5’-GAGTGCAGAGGGAGGTAGAC-3’; β-Actin-F, 5’-CTGGAACGGTGAAGGTGACA-3’, β-Actin-R, 5’- AAGGGACTTCCTGTAACAACG.
CA -3’. β-Actin was used as an endogenous control and relative gene expression was calculated using the 2−ΔΔCt method.
Western blot analysisCells were lysed in cold RIPA extraction reagent (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.5% sodium deoxycholate, 1% NP-40, and 0.1% SDS) supplemented with protease inhibitor (Roche, German). Total protein concentration was measured with Enhanced BCA Protein Assay kit (Beyotime, China) following the manufacture’s instruction. Protein lysates were separated using 10–12.5% polyacrylamide gel electrophoresis and transferred to PVDF membrane (Millipore, USA). The membrane was blocked with 5% BSA in TBST for 1 h at room temperature, then incubated with a primary antibody at 4℃ overnight. Then the membrane was washed three times using 0.1% TBST buffer for 30 min and incubated with HRP-conjugated secondary antibodies for 1 h at room temperature, followed by three times TBST buffer washing for 30 min. The HRP-conjugated secondary antibody was detected and visualized by ECL reagent (GE Healthcare, USA). The following antibodies were used in western blotting: anti SIN1 (Proteintech, 15463-1-AP, China), anti ERK (Proteintech, 11257-1-AP, China), anti P-ERK (Proteintech, 28733-1-AP, China), anti β-tubulin (Proteintech, 66240-1-lg, China) and anti GAPDH (HUABIO, ET1601-4, China).
Immunofluorescence stainingFirst, slides were treated with 0.05 mg/mL poly-L-lysine for 2 h, and then cells were seeded. Next, slides with grown-on cells in culture plates were rinsed three times with 1 mL of room-temperature PBS, with a 5 min incubation each time. Then, cells were fixed with 500 µL of 4% paraformaldehyde for 20 min. After that, slides were washed three times with 1 mL PBS, 5 min per wash. Next, 500 µL of 0.1% Triton X-100 was added for permeabilization at 4 °C for 5 min. Then, slides were washed three times with 1 mL PBS again, 5 min each. After removing PBS, 500 µL of 3% BSA was added and incubated at room temperature for 30 min to block nonspecific binding. The blocking solution was then aspirated without subsequent washing. Next, 50 µL of primary antibody diluted in 1% BSA was added, and the slides were placed in a humidified chamber at 4 °C overnight. Then, slides were washed three times with PBS, 5 min each. After removing the liquid on the slides, the diluted fluorescent secondary antibody (1:1000 in 1% BSA) was added and incubated at 37 °C for 1 h in a humidified chamber. After another three 5 min PBS washes, the slides were rinsed briefly in 50 mL water. The liquid was then removed, and the slides were mounted with antifade mounting medium containing DAPI. After mounting, slides were left at room temperature in the dark for over 2 h. Once the mounting medium dried, slides were stored at 4 °C in the dark. Finally, after mounting was complete, images were acquired promptly using a fluorescence microscope. The following primary antibodies were used: SIN1 (Proteintech, 15463-1-AP, China), KRAS4A (Proteintech, 12063-1-AP, China).
Co-immunoprecipitation (Co-IP)Cells were harvested and washed with cold phosphate-buffered saline (PBS) before being lysed in a buffer containing protease inhibitors. The lysate was centrifuged at 14,000 rpm for 10 min at 4 °C, and the supernatant was collected. To reduce non-specific binding, the supernatant was pre-cleared with protein A/G agarose (MCE, HY-K0230, USA) beads for 30 min at 4 °C. Subsequently, a specific antibody against the target protein was added, and the mixture was incubated overnight with gentle rotation at 4 °C. Afterward, protein A/G agarose beads were added to capture the antibody-protein complexes, followed by 2 h incubation. The beads were washed three times with cold lysis buffer to eliminate non-specific interactions, and the bound proteins were eluted using an SDS-containing elution buffer. The eluted proteins were then analyzed by SDS-PAGE and Western blotting to confirm the presence of the target protein and its interacting partners. The following antibodies were used in western blotting: anti SIN1 (Proteintech, 15463-1-AP, China), anti KRAS4A (Proteintech, 12063-1-AP, China).
CCK-8 assayCell viability was measured using Cell Counting Kit-8 (APExBIO, USA) according to the manufacturer’s instruction. Cells were plated at a density of 7 × 103 cells per well in 96-well plates with six replicates. Then, one hundred microliters of serum-free cell culture medium containing 10 µL WST-8 reagent was added into each well at desired time points and the plates were incubated in cell culture incubator for 3 h. Optical absorbance of each well at 450 nm was measured with a microplate reader. At least three independent experiments were performed for quantification.
Transwell assayTranswell assay was performed using the 8 μm transwell chambers (BD Biosciences, San Jose, CA) according to the manufacturer’s instructions as previously described [19]. Briefly, U251 and U118 cells (1 × 105 cells/well) were suspended in DMEM without FBS being plated into the upper chamber, and 10% serum-containing DMEM was added to the lower chamber. The chambers were then incubated at 25℃ for 24 h. After incubation, the unmigrated cells on the upper side of the membrane were wiped with a cotton swap, while the migrated cells on the bottom side of the membrane were fixed by 4% PFA and stained with crystal violet (Beyotime, China). The stained cells were imaged (3 images/well) and manually counted from the images.
Flow cytometryFor cell cycle analysis, cell cycle detection kit (Keygen Biotech, China) was used according to the manufacturer’s protocol. In brief, the collected suspended cells (1 × 106 cells/mL) were fixed in 70% ice-cold ethanol overnight. Then the cells were washed and incubated with 500 µL staining buffer (RnaseA: PI = 9: 1) in dark for 30 min at room temperature. Samples were analyzed by the BD FACS Canto II Cytometer (Germany) immediately. At least three independent experiments were performed for quantification.
For apoptosis analysis, Annexin-V-Alexa Fluor 647/PI apoptosis detection kit (Fcmacs, China) was used according to the protocol of manufacturer. In brief, cells were harvested using trypsin without EDTA to produce the single cell suspension. Then cells were resuspended in 100 µL 1 × binding buffer at a concentration of 1 × 106 cells/mL, followed by staining with 5 µL Annexin-V-Alexa Fluor 647 and 10 µL 20 µg/mL Propidium Iodide in dark for 15 min at room temperature. Flow cytometry analyzed the samples immediately (FACS Canto II, Germany). At least three independent experiments were performed for quantification. For SIN1-overexpressing U251 and U118 cells treated with 120 µM and 400 µM Temozolomide (TMZ), respectively, for three days, apoptosis levels were assessed.
Glioma xenografts and in vivo imaging systemLentivirus carrying luciferase, sourced from OBiO, China, was used to infect both SIN1 stably knockdown and negative control U118 cells. Cell lines with stable GFP-Luc expression were systematically isolated. The BALB/c Nude mice were randomly divided into two groups, each group consisting of eight mice. Well-growing luciferase labeled SIN1 stable knockdown and control U118 glioma cells were prepared. Each mouse was inoculated with 1 × 106 cells in 5 µL PBS. All mice were anesthetized with 1.5% pentobarbital sodium (6 µL/g). 1 × 106 cells in 5 µL ice-cold PBS were subsequently injected into the right cerebral cortex (2 mm to the right of the anterior fontanel, 1 mm anterior to the coronal suture, and 3 mm beneath the skull). The growth of the tumor was monitored using Night OWL II LB 983 in vivo imaging system bioluminescent Imaging (Berthold Technologies, Germany). After ether anesthesia, the mice were euthanized by cervical dislocation, and brain tissue was collected for H&E staining.
Bioinformatic analysisThe expression analyses were conducted via R package “ggplot2”, “stats” and “car”. Univariate and multivariate Cox regression analyses were conducted via R package “survival”. The ROC curve was plotted via R package “ggplot2” and “pROC”.
Survival analysisThe survival analysis of glioma between SIN1 high-expression and low expression groups was performed by Kaplan–Meier method and Cox regression. The Kaplan–Meier survival curves were plotted via R package “ggplot2”, “survival” and “survminer”.
Protein-protein interaction (PPI) network analysisThe PPI network analysis was acquired using the STRING website (https://string-db.org/). To conduct the analysis, the protein name “SIN1” and the organism “Homo sapiens” were searched. The following basic settings were applied: network type was set to “full STRING network,” the meaning of network edges was defined as “evidence,” active interaction sources were selected as “experiments,” the minimum required interaction score was set to “medium confidence (0.400),” and the maximum number of interactors displayed was limited to “no more than 20 interactors in the first shell.”
Transcriptome sequencing analysisTotal RNA of SIN1 silenced U251 was extracted by Trizol reagent (Invitrogen) and sequenced by using Illumina HiSeq2500 (Gene Denovo Biotechnology, Guangzhou, China). RNA sequencing data were deposited in the Sequence Read Archive (SRA) (https://www.ncbi.nlm.nih.gov/sra), the accession number was PRJNA1206313. The volcano plot of differentially expressed genes was generated using R package “EnhancedVolcano”. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed on differentially expressed genes (DEGs) using the R package “clusterProfiler” to elucidate the potential biological functions and signaling pathways influenced by SIN1. The GO analysis included assessments of biological processes (BP), cellular components (CC), and molecular functions (MF). Additionally, Gene Set Enrichment Analysis (GSEA) was conducted to explore pathways associated with SIN1, utilizing the MSigDB Collection (c2.cp.v7.2.symbols.gmt) within the clusterProfiler R package.
Single-cell RNA sequencing analysisThe single-cell data of glioma was obtained from GEO database (GSE131928) [20]. The single-cell gene expression was further analyzed using the open-source single-cell sequencing database: Single Cell Portal.
Immune infiltration analysisThe RNA-seq expression data and clinical data were obtained from TCGA database, the values were further log-transformed (log2 (value + 1)). The immune infiltration levels corresponding to glioma were calculated based on Single-Sample GSEA (ssGSEA) algorithm provided in the R package “GSVA” and markers of immune cell types [21]. The lollipop and scatter plots were generated using the R package “ggplot2”. The correlation analysis was performed by chi-square (χ2) test, Pearson’s correlation, or Spearman’s correlation analysis.
Statistical analysisStatistical analyses were performed with GraphPad Prism software (version 9.5.0, Graphpad Software, Inc.). The statistical test for two groups used student’s t-test, for more than two groups used one-way ANOVA or Kruskal-Wallis test. Statistical acquired from TCGA were merged and conducted by R (4.2.1).
Comments (0)