Small regulatory RNAs, such as small interfering RNAs (siRNAs) and PIWI-interacting RNAs, regulate splicing, transcription, and genome integrity in many eukaryotes. In Caenorhabditis elegans, siRNAs bind nuclear Argonautes (AGOs), which interact with homologous premessenger RNAs to recruit downstream silencing effectors, such as NRDE-2, to direct cotranscriptional gene silencing [or nuclear RNA interference (RNAi)]. To further our understanding of the mechanism of nuclear RNAi, we conducted immunoprecipitation-mass spectrometry on C. elegans NRDE-2. The major NRDE-2 interacting protein identified was the RNA helicase MTR-4. Co-immunoprecipitation analyses confirmed a physical association between NRDE-2 and MTR-4. MTR-4 colocalizes with NRDE-2 within the nuclei of most/all C. elegans somatic and germline cells. MTR-4 is required for nuclear RNAi, and interestingly, MTR-4 is recruited to premessenger RNAs undergoing nuclear RNAi via a process requiring nuclear siRNAs, the nuclear AGO HRDE-1, and NRDE-2, indicating that MTR-4 is a component of the C. elegans nuclear RNAi machinery. Finally, we confirm previous reports showing that human (Hs)NRDE2 and HsMTR4 also physically interact. Our data show that the NRDE-2/MTR-4 interactions are evolutionarily conserved, and that, in C. elegans, the NRDE-2/MTR-4 complex contributes to siRNA-directed cotranscriptional gene silencing.
SMALL regulatory RNAs are important regulators of genome stability and gene expression in the nuclei of many eukaryotes. The biological functions for nuclear small RNAs include repressing parasitic nucleic acids such as transposons, regulating transcription, modifying chromatin states, directing DNA methylation, coordinating genome rearrangement, silencing unpaired DNA, and promoting epigenetic inheritance. The mechanisms by which small regulatory RNAs control many of these processes are poorly understood (Castel and Martienssen 2013).
In Caenorhabditis elegans, cytoplasmically produced small regulatory RNAs enter the nuclei to regulate transcription via a process referred as cotranscriptional gene silencing (cTGS) or nuclear RNA interference (RNAi; Bosher et al. 1999; Guang et al. 2008). Forward genetic screens in C. elegans identified five proteins (NRDE-1/2/3/4 and HRDE-1) that are required for nuclear RNAi (Guang et al. 2008, 2010; Buckley et al. 2012). HRDE-1 and NRDE-3 are Argonaute (AGO) proteins that direct nuclear RNAi in C. elegans germ cells and somatic cells, respectively (Guang et al. 2008; Buckley et al. 2012). According to current models, HRDE-1 and NRDE-3 Ago proteins engage small interfering RNAs (siRNAs) in the cytoplasm and escort these siRNAs into the nuclei (Guang et al. 2008; Buckley et al. 2012). Once inside the nuclei, AGO/siRNA complexes base-pair with complementary nascent RNAs emanating from elongating RNA Polymerase II (RNAP II) complexes (Guang et al. 2008; Buckley et al. 2012). HRDE-1/NRDE-3 then recruit NRDE-2, which is an evolutionarily conserved protein possessing half a tetracopeptide (HAT) repeats often found in RNA binding proteins, to pre-mRNA (Preker and Keller 1998; Guang et al. 2010). NRDE-2 recruits NRDE-4, which then recruits NRDE-1 (Burkhart et al. 2011). The hierarchical assembly of NRDE factors onto pre-mRNAs leads to inhibition of RNAP II transcription elongation (Guang et al. 2010) and directs the deposition of repressive chromatin marks, such as H3K9me3 and H3K27me3 on chromatin of genes undergoing nuclear RNAi (Guang et al. 2010; Burkhart et al. 2011; Gu et al. 2012; Mao et al. 2015). Recent studies have linked Aquarius/EMB-4, which is a conserved RNA helicase involved in pre-mRNA splicing in mammalian cells (Hirose et al. 2006; Kuraoka et al. 2008; De et al. 2015), to nuclear RNAi in C. elegans (Akay et al. 2017; Tyc et al. 2017). Aquarius/EMB-4 physically interacts with the nuclear AGO HRDE-1 and may promote nuclear RNAi by allowing the NRDE factors to compete with splicing machinery for access to nascent RNAs (Akay et al. 2017). A complete understanding of the mechanism(s) by which NRDE nuclear RNAi factors inhibit transcription, or modify chromatin states, at the direction of small nuclear RNAs is lacking.
Eukaryotic cells possess a number of RNA quality-control systems that monitor messenger RNA (mRNA) expression, processing, trafficking, and translation. One such system is mediated by the nuclear exosome, which is composed of 11 proteins that degrade or process many RNAs produced by RNA polymerases I, II, and III (Ogami et al. 2018). Nine of the 11 exosome proteins form a structural channel through which RNAs are threaded for degradation or processing. The remaining two proteins, Rrp6 and Dis3, are catalytically active and are thought to degrade or process RNA targets of the nuclear exosome (Ogami et al. 2018). The RNA degradation targets of the exosome include RNAP II transcripts harboring splicing and/or 3’ end processing defects (Hilleren et al. 2001; Milligan et al. 2005; Lemieux et al. 2011), as well as noncoding RNAs produced by constitutive and pervasive genome transcription (Preker et al. 2008; Flynn et al. 2011; Henriques et al. 2013; Szczepińska et al. 2015; Ogami et al. 2017). The RNA processing targets of the exosome include ribosomal RNAs, total RNAs, small nucleolar RNAs, and small nuclear RNAs (Lebreton et al. 2008; Schaeffer et al. 2009; Schneider et al. 2009; Zinder and Lima 2017).
Adaptor complexes couple different RNAs to the nuclear exosome. In mammals, three adaptor complexes are known and are referred to as TRAMP (Trf4-Air-Mtr4 polyadenylation) (LaCava et al. 2005; Wyers et al. 2005; Houseley et al. 2007; Reis and Campbell 2007), NEXT (Nuclear Exosome Targeting complex, Mtr4-ZCCHC8-Rbm7) (Lubas et al. 2011), and PAXT [poly(A) tail exosome targeting, Mtr4-ZFZ3H1-PABPN1] (Meola et al. 2016; Ogami et al. 2017). The DEXD box RNA helicase Mtr4 (also SKIV2L2, Dob1, or Mtrex) is a core component of each of these complexes, where it promotes RNA degradation/processing by bridging adaptor complexes and the nuclear exosome (de la Cruz et al. 1998; van Hoof et al. 2000; LaCava et al. 2005; Wyers et al. 2005; Cristodero and Clayton 2007; Houseley et al. 2007; Reis and Campbell 2007; Schilders et al. 2007; Holub and Vanacova 2012; Thoms et al. 2015).
The nuclear RNAi factor NRDE2 and MTR4 form a 1:1 complex in mammalian cells (Richard et al. 2018; Jiao et al. 2019; Wang et al. 2019). In mammalian cells, the NRDE2/MTR4 complex protects the genome from DNA damage via an unknown mechanism (Richard et al. 2018; Jiao et al. 2019), and regulates pre-mRNA levels, ensuring pre-mRNA quality by regulating exosome-based pre-mRNA degradation (Wang et al. 2019) and/or promoting pre-mRNA splicing at genes harboring poor-quality introns (Jiao et al. 2019). How the pre-mRNA quality control and genome protection functions of the NRDE2/MTR4 complex relate to each other is not known. Interestingly, a NRDE-2-like-1 protein (Nrl1) and a paralog of Mtr4 (termed Mtr4-like-1 or Mtl1) form a complex in the fission yeast Schizosaccharomyces pombe, hinting that associations between NRDE-2-like and Mtr4-like proteins are deeply conserved (Lee et al. 2013; Zhou et al. 2015; Aronica et al. 2016). The fungal NRDE-2/Mtr4-like complex is linked to the degradation of mis-spliced RNAs via the nuclear exosome (Zhou et al. 2015), and the promotion of cryptic intron splicing via a pathway that may involve small interfering RNAi-directed chromatin modification (Lee et al. 2013). Loss of the fungal NRDE-2/Mtr4-like complex in S. pombe leads to DNA damage (Aronica et al. 2016). Thus, NRDE-2/Mtr4(-like) complexes contribute to nuclear RNA surveillance and genome protection in mammalian and fungal cells. Nonetheless, the molecular mechanism(s) by which the complex surveilles pre-mRNA production in fungi, or if this process is conserved in eukaryotes, is not understood.
Here, we show that C. elegans NRDE-2 and MTR-4 interact physically, confirming that the NRDE-2/MTR-4 complex represents a deeply conserved gene regulatory module. We also show that C. elegans (ce)MTR-4 is recruited to nascent RNAs undergoing nuclear RNAi, that this recruitment is dependent upon nuclear siRNAs and NRDE-2, and that association of MTR-4 with NRDE-2 and pre-mRNA is necessary for nuclear siRNAs to trigger cTGS. These latter data establish that the NRDE-2/MTR-4 complex is a component of the C. elegans cTGS machinery.
Materials and MethodsStrainsWT N2, YY913 nrde-2 (gg518 [nrde-2::3xflag::ha]), YY1168 mtr-4 (gg588 [3xflag::gfp::mtr-4]), YY1169 mtr- 4 (gg588); nrde-2 (gg518), YY1362 nrde-2 (gg624[ ha::tagrfp::nrde-2]); mtr-4 (gg588), CA1199 ieSi38 [sun- 1p::TIR1::mRuby::sun-1 3UTR], CA1200 ieSi57 [eft-3p::TIR1::mRuby::unc-54 3UTR], YY1540 mtr-4 (gg648 [gfp::3xflag::degron::mtr-4]); ieSi38, YY1440 nrde-2 (gg91); mtr-4 (gg588),YY1539 mtr-4 (gg648); ieSi38; nrde-2 (gg518), YY1541 mtr-4 (gg648), YY1557 mtr-4 (gg648); eri-1(mg366); ieSi57, YY1561 mtr-4 (gg648); ieSi57, YY1566 npp-9 (gg654[tagrfp::SEC::3xflag::npp-9]); mtr-4 (gg588), YY1572 hrde-1(tm1200); mtr-4 (gg588), YY1585 nrde-1 (gg88); mtr-4 (gg588)C. elegans husbandry and genetics were performed as described previously (Brenner 1974). Some strains were provided by the CGC (P40 OD010440). Some strains were made by CRISPR, as described previously (Wan et al. 2018).
Mass spectrometryWe collected ∼100,000 young adults (N2 and YY913), which were then flash frozen in liquid nitrogen. Animals were ground into powder in a mortar bathed in liquid nitrogen. Powder were resuspended in 1× lysis buffer (20 mM HEPES pH 7.5, 100 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 10% glycerol, 0.25% Triton X-100, 1 mM freshly made PMSF, 1× complete protease inhibitor without EDTA; from Roche) and rotated for 45 min to 1 hr at 4°. Lysate was cleared by centrifuging at 13,000 rpm for 10 min. Supernatant was filtered with a 0.45 μm filter unit (SLHP033RS; Millipore). Filtered supernatant was incubated with FLAG M2 antibody (F1804; Sigma-Aldrich) conjugated to Dynabeads Protein G (10004D; Thermo Fisher Scientific) for 2 hr. Beads were washed four times with a 1× lysis buffer. Proteins were eluted with 500 mM NH4OH by rotating for 20 min at 37°. Then, 10% of elution was subjected to SDS-PAGE and silver staining (1610449; Bio-Rad). Remaining protein was subjected to Trichloroacetic acid precipitation and mass spectrometry on an Orbitrap liquid chromatography tandem mass spectrometry mass spectrometer.
Co-immunoprecipitationFor co-immunoprecipitation in C. elegans, ∼20,000 young adult animals were collected and flash frozen in liquid nitrogen. Animals (YY913, YY1168, and YY1169) were resuspended in 1× lysis buffer [20 mM HEPES pH 7.5, 100 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 10% glycerol, 0.25% Triton X-100, 1 mM freshly made PMSF, 1× complete protease inhibitor without EDTA (Roche)] and sonicated (30 sec on, 30 sec off, 30% output for 2 min on a Qsonica Q880R sonicator, repeated four times) to lyse. Lysate was centrifuged at 13,000 rpm at 4° for 10 min and precleared with protein A agarose beads at 4° for 30 min. For immunoprecipitation of NRDE-2, supernatants were incubated with Anti-HA Affinity Matrix (clone 3F10; Roche) for 4 hr. For immunoprecipitation of MTR-4, supernatants were incubated with GFP antibody (ab290; Abcam) for 4 hr, followed by protein A for 2 hr. Beads were washed four times with 1× lysis buffer. Input and immunoprecipitated protein were separated by SDS-PAGE and detected with HA antibody (ab9110; Abcam), GFP antibody (ab290; Abcam), and Tubulin antibody (E7; Developmental Studies Hybridoma Bank). For co-immunoprecipitation in human cells, GFP::HsMTR-4 (kindly donated by the laboratory of Stephen Elledge) was transfected into 3xFLAG::NRDE-2 HEK293T cells (Jiao et al. 2019) with lipofectamine 2000, cells were resuspended in 1× lysis buffer for 30 min, followed by sonication (30 sec on, 30 sec off, 20% output for 2 min). Immunoprecipitation and Western blotting was performed as described above.
RNA immunoprecipitationRNA immunoprecipitations were done as described previously (Guang et al. 2010). Briefly, ∼20,000 young adults or ∼300,000 embryos were collected and flash frozen in liquid nitrogen. Samples were resuspended in sonication buffer (20 mM Tris-HCl pH 7.5, 200 mM NaCl, 2.5 mM MgCl2, 10% glycerol, 0.5% NP-40, 80U/ml RNaseOUT, 1 mM DTT and 1× protease inhibitor cocktail without EDTA) and sonicated (30 sec on, 30 sec off, 30% output for 2 min on a Qsonica Q880R sonicator, repeated once). Lysates were clarified by centrifugation at 14,000 rpm for 15 min. Supernatants were precleared with protein A agarose beads and incubated with FLAG M2 agarose beads (A2220; Sigma-Aldrich) for 2 hr at 4°. Beads were washed six times with RNA immunoprecipitation buffer (20 mM Tris-HCl pH 7.5, 200 mM NaCl, 2.5 mM MgCl2, 10% glycerol, 0.5% NP-40). Protein and associated RNAs were eluted with 100 μg/ml 3xFLAG peptide (F4799; Sigma-Aldrich). RNAs were treated with Turbo DNase I for 20 min at 37° and then extracted with TRIzol reagent followed by precipitation with isopropanol. Precipitated RNAs were reverse transcribed with iScript complementary DNA (cDNA) synthesis kit and quantified with quantitative PCR (qPCR).
Auxin treatmentAuxin treatments were done as described previously (Zhang et al. 2015). Briefly, auxin indole-3-acetic acid (A10556; Alfa Aesar) was dissolved in ethanol to make a 400 mM stock (stored at 4° for up to 1 month). Auxin was added to NGM agar or RNAi agar growth plates at a final concentration of 1 mM. Auxin treatment was done by putting embryos or transferring animals of indicated developmental stages to bacteria seeded plates containing auxin. Auxin-mediated protein degradation persists for 10–24 hr after C. elegans are removed from auxin (Zhang et al. 2015). For short-term MTR-4 depletion experiments described in this work, animals were exposed to ±1 mM auxin treatment for 5 or 10 min, or 2 hr (as indicated), and then transferred to auxin-free RNAi plates seeded with control bacteria or bacteria producing oma-1/lin-15b/lir-1 double-stranded RNA (dsRNA).
RNAi assayRNAi experiments were performed as described previously (Timmons et al. 2001). dsRNA-expressing bacteria, including lir-1 and oma-1, were obtained from Ahringer RNAi library and sequenced to confirm their identity. lin-15b dsRNA-expressing bacteria was described previously (Guang et al. 2010). The mtr-4 RNAi clone was constructed by PCR amplification of genomic DNA with primers (CGCGGTGGCGGCCGCTCTAGA TGCACAATGATGTCGGAGTTG and GTCGACGGTATCGATAAGCTT TCATCGCGTCTCTGAATTTG), and inserted into EcoRI/HindIII linearized L4440 vector by homologous recombination in Escherichia coli DH5a. For double RNAi treatments, HT115 bacteria expressing lir-1 dsRNAs were diluted with HT115 bacteria expressing nrde-2 dsRNAs (ratio of lir-1 to nrde-2 is 1:1), or mtr-4 dsRNAs (1:0.2 to 1:1, and filled with L4440 control if necessary).
H3K9me3 chromatin immunoprecipitationApproximately 10,000 gfp::degron::mtr-4; sun-1::tir1::sun-1 3’UTR young adult animals were put on 1 mM auxin plates for 2 h, and transferred to auxin-free plates seeded with bacteria expressing control dsRNA (L4440) or oma-1 dsRNA; animals were collected 30 hr later, flash frozen in liquid nitrogen, and stored at −80°. Samples were cross-linked in 2% formaldehyde at room temperature for 30 min, the reaction was terminated with 0.125 M glycine and washed twice with M9. Cross-linked samples were resuspend in FA buffer (50 mM Tris-HCl pH 7.5, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 150 mM NaCl) supplemented with 1× complete protease inhibitor without EDTA (Roche), and sonicated (30 sec on, 30 sec off, 70% output for 25 min on a Qsonica Q880R sonicator). Lysates were clarified by centrifugation at 14,000 rpm for 15 min. Supernatants were precleared with protein A agarose beads and incubated with H3K9me3 antibody (07-523; Upstate (Sigma-Aldrich)) overnight. H3K9me3 antibody were precipitated with protein A agarose beads and washed sequentially with FA buffer twice, FA-500 buffer (50 mM Tris-HCl pH 7.5, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 500 mM NaCl) twice, LiCl buffer (0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl pH 8.0) once, and TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA) twice. Antibodies were eluted with an elution buffer (1% SDS, 0.1 M sodium bicarbonate) and H3K9me3/DNA were reverse cross-linked with 0.3 M NaCl at 65°, overnight. Precipitated DNA was purified with gel extraction kit and quantified with qPCR.
ImmunofluorescenceA total of 20–40 animals in 1× egg buffer (25 mM HEPES, pH 7.3, 118 mM NaCl2, 48 mM KCl, 2 mM CaCl2, 2 mM MgCl2) were dissected on a superfrost plus slide with a needle, and then a coverslip was placed on top of the dissected animals. The slide was placed on a metal block at −80° (precooled to −80°) and the coverslip was popped off with a razor blade. The animals were treated with cold methanol for 10 min at −20°, followed by two washes with PBST (1 × PBS with 0.1% Tween20). The animals were then fixed with 100 μl of fixation buffer (4% paraformaldehyde in PBS) with a coverslip-size parafilm on top, in a humid chamber for 20 min, followed by two washes with 1× PBST. The animals were incubated in 100 μl diluted primary antibody (GFP: ab13970, Abcam; HA: 3724S, Cell Signaling Technology) with a coverslip-size parafilm on top, at room temperature overnight in a humid chamber. The next day, samples were washed with 1× PBST three times and then incubated with 100 μl diluted secondary antibody (goat anti-chicken secondary antibody Alexa Fluor 488: A11039, Thermo Fisher Scientific; goat anti-rabbit antibody Alexa Fluor 568: A11011, Thermo Fisher Scientific) with a coverslip-size parafilm on top, at room temperature for 90 min. After washing with 1× PBST three times, samples were mounted with an antifade mounting medium (H-1000; Vectashield) and sealed with nail polish.
Microscope and microscopy infoImaging was done as described previously (Wan et al. 2018). Larval or young adult animals were immobilized with 0.1% sodium azide and mounted on glass slides before imaging. Embryos were obtained by dissecting gravid young adults in 1× egg buffer on a coverslip. Animals or embryos were imaged immediately with a Nikon Eclipse Ti microscope equipped with a W1 Yokogawa Spinning disk with 50-μm pinhole disk and an Andor Zyla 4.2 Plus sCMOS monochrome camera. Images were taken under ×60/1.4 Plan Apo Oil objective. Immunofluorescence samples were imaged with a Leica DMi8 microscope equipped with a laser scanning confocal under ×63 oil objective.
qPCRcDNA or DNA was qualified with SYBR green according to the vendor’s instructions. Primers for qPCR can be found in Primers used in this study subsection at the end of Supplemental Material.
ResultsIdentification of C. elegans NRDE-2 associating proteinsForward genetic screens have identified five components of the C. elegans nuclear RNAi machinery (NRDE-1/2/3/4 and HRDE-1) (Guang et al. 2008, 2010; Burkhart et al. 2011; Buckley et al. 2012). To identify essential and/or redundant components of the nuclear RNAi machinery, we used immunoprecipitation–mass spectrometry (IP-MS) to isolate proteins associating physically with C. elegans NRDE-2 (Guang et al. 2010). We first used CRISPR/Cas9 to introduce a 3xflag::ha epitope to the nrde-2 locus (Figure S1). The resulting fusion gene encoded a functional protein (Figure S1). We then used α-FLAG antibodies to conduct α-FLAG immunoprecipitations from extracts generated from nrde-2::3xflag::ha, or wild-type, adult stage animals. Silver staining revealed that immunoprecipitation from NRDE-2::3xFLAG::HA extracts purified proteins not present in immunoprecipitation from wild-type extracts (Figure 1A). Copurifying proteins were subjected to liquid chromatography–tandem mass spectrometry. Proteins identified by ≥20 peptides from nrde-2::3xflag::ha extracts, and zero peptides from wild-type extracts, were considered candidate NRDE-2 interacting proteins (Table S1). HRDE-1, NRDE-1, and NRDE-4, which are known to interact with NRDE-2 (Guang et al. 2010; Burkhart et al. 2011; Buckley et al. 2012), were identified as top 10 NRDE-2 interacting proteins, indicating that our NRDE-2 IP-MS was likely successful (Figure 1B). NRDE-3, which is another known NRDE-2 interacting protein, was also identified in the NRDE-2 IP-MS analysis, albeit at lower levels than other known NRDE-2 interacting proteins (Guang et al. 2010) (Table S1). Remaining NRDE-2 interacting proteins are candidate novel nuclear RNAi factors.

Figure 1 MTR-4 interacts with NRDE-2 in C. elegans. (A) Silver-stained gel of α-FLAG precipitated proteins from wild-type (control, N2 Bristol) or nrde-2::3xflag::ha animals. (B) Y-axis, Log10 of total peptides identified. X-axis, Molecular weight (MW) of NRDE-2 co-immunoprecipitating proteins. Proteins previously thought to interact with NRDE-2 are shown in red. Components of the U5 snRNP are shown in green. A complete list of proteins identified by more than 20 peptides in nrde-2::3xflag::ha animals and zero peptides in wild type is shown in Table S1, sheet 1. A list of all proteins identified by NRDE-2 IP-MS is shown in Table S1, sheet 2. (C) Reciprocal co-immunoprecipitation analyses of NRDE-2::3xFLAG::HA (IP: HA) and 3xFLAG::GFP::MTR-4 (IP: GFP) is shown. Co-immunoprecipitating proteins were detected by Western blot (anti-HA or anti-GFP). Tubulin was used as a loading control. Presence/absence of indicated proteins in co-immunoprecipitation extracts (input) is shown. Asterisks indicate smaller MW weight NRDE-2::FLAG::HA species. These smaller NRDE-2 species may indicate the presence of multiple nrde-2 isoforms or protein degradation occurring in vivo or in vitro.
MTR-4 is a NRDE-2 interacting proteinThe DEXD RNA helicase MTR-4 was identified by over ten times more peptides than any other NRDE-2 interacting protein (Table S1). To confirm that NRDE-2 and MTR-4 interact, we introduced a 3xflag::gfp epitope immediately preceding the predicted atg start codon of the mtr-4 locus (see Materials and Methods), and then conducted genetic crosses to generate animals expressing both 3xFLAG::GFP::MTR-4 and NRDE-2::3xFLAG::HA. We then used ɑ-GFP and ɑ-HA antibodies to conduct NRDE-2 and MTR-4 co-immunoprecipitation analyses. This analysis confirmed that MTR-4 and NRDE-2 physically associate (Figure 1C). Previous studies have demonstrated an interaction between mammalian NRDE2 and MTR4 (Ogami et al. 2017; Richard et al. 2018; Jiao et al. 2019). We confirmed this interaction by conducting human (Hs)NRDE2 and (Hs)MTR4 co-immunoprecipitation analysis from extracts generated from HEK293T cells coexpressing GFP::HsMTR4 and 3xFLAG::HsNRDE2 (Figure S2). We conclude that NRDE-2 physically associates with MTR-4, and that the interaction between these two proteins is conserved from nematodes to mammals.
C. elegans MTR-4 is a ubiquitously expressed nuclear proteinWe used CRISPR/Cas9 to introduce a tagrfp tag into the npp-9 gene, which encodes a component of the nuclear pore and, consequently, marks the nuclear membrane of somatic and germ cells. We then used fluorescence microscopy to visualize animals coexpressing TagRFP::NPP-9 and 3xFLAG::GFP::MTR-4. The analysis showed that MTR-4 was expressed diffusely within nuclei of all embryonic cells (Figure 2A) as well as most/all somatic cells in larval animals (Figure S3). The data show that MTR-4 is a ubiquitously or near-ubiquitously expressed, nuclear-localized protein.

Figure 2 MTR-4 is a nuclear protein that partly colocalizes with NRDE-2 in all/most cells. (A) Fluorescence micrographs of an ≅32 cell embryo or ∼15 pachytene stage adult germ cells expressing GFP::MTR-4 (green) and TagRFP::NPP-9 (magenta). NPP-9 is a component of the nuclear pore and marks nuclear membranes. (B and C) Fluorescence micrographs of (B) embryos or (C) adult pachytene germ cells expressing GFP::MTR-4 and HA::tagRFP::NRDE-2. Immunofluorescence using GFP and HA antibodies against animals expressing GFP::MTR-4 (green) and HA::TagRFP::NRDE-2 (magenta). (D) Inset of one nucleus from C. Bar, (A) embryos: 10 μm, germline: 5 μm; (B) 10 μm; (C) 20 μm; (D) 2 μm.
To further explore the relationship between NRDE-2 and MTR-4 in the nuclei of these cells, we conducted ɑ-HA and ɑ-GFP immunofluorescence on HA::TagRFP::NRDE-2 and 3xFLAG::GFP::MTR-4 expressing C. elegans. Immunofluorescence analysis showed that HA::TagRFP::NRDE-2 was expressed in the nuclei of all/most cells of developing embryos, a result consistent with previous reports on NRDE-2 expression patterns (Figure 2B) (Guang et al. 2010). In these cells, 3xFLAG::GFP::MTR-4 and HA::TagRFP::NRDE-2 were diffusely expressed and colocalized in nuclei (Figure 2B). We also detected 3xFLAG::GFP::MTR-4 and HA::TagRFP::NRDE-2 expression in the germline (Figure 2C). Previous reports failed to detect NRDE-2 expression in germ cells (Guang et al. 2010), a discrepancy likely due to these earlier studies using transgenesis systems prone to silencing in the germline (Mello and Fire 1995; Kelly et al. 1997). In adult C. elegans pachytene stage germ cells, MTR-4 and NRDE-2 appeared largely colocalized with both proteins concentrated near the nuclear periphery, which is the site of chromatin localization in these cells (Goldstein 1982) (Figure 2D). Finally, MTR-4, but not NRDE-2, localized to the nuclear interior of germ cells (Figure 2D, inset). We conclude that C. elegans MTR-4 is a nuclear protein expressed in most, and likely all, C. elegans cells, and that MTR-4 and NRDE-2 partially colocalize within nuclei of these cells.
MTR-4 is essential for fertility and developmentPrevious studies have shown that RNAi-based knockdown of MTR-4 causes sterility and larval arrest (Simmer et al. 2003). These data suggest that MTR-4 is likely to have essential functions in both the soma and the germline. We obtained a strain (RB1997) thought to harbor a deletion allele of mtr-4 (termed (ok2642)). ok2642 is predicted to delete ≅30% of the mtr-4 gene downstream of the DEAD box helicase domain, throwing all downstream sequences, which include additional conserved domains, out of frame (Figure S4A). We were surprised to find that mtr-4(ok2642) animals did not exhibit obvious fertility or developmental defects when grown under standard laboratory conditions. We wondered, therefore, if ok2642 was actually a null of mtr-4. Indeed, PCR-based genotyping analyses hinted that ok2642 was likely a complex deletion/duplication of the mtr-4 locus, possibly capable of producing full-length functional MTR-4 protein (Figure S4, B and C). Thus, for clarity, we used CRISPR/Cas9 to generate a new deletion allele of mtr-4 that lacked the highly conserved MTR-4 DEAD box helicase domain [termed mtr-4(ΔDEAD box)] (Figure S4D). We easily identified animals heterozygous for the ΔDEAD box deletion, but never animals that were homozygous for the deletion (0/60) (Figure S4E). This result supports the idea that the mtr-4 ΔDEAD box allele is homozygous lethal, that C. elegans MTR-4 is indeed essential, and that ok2642 is not a true null allele of mtr-4. Therefore, to study the function of mtr-4 and, more specifically, ask if MTR-4 is needed for nuclear RNAi, we sought to develop genetic tools that would allow for conditional depletion of MTR-4. We used CRISPR/Cas9 to introduce a degron::gfp tag to mtr-4 and then generated animals expressing degron::GFP::MTR-4 and the TIR1 E3 ubiquitin ligase in either the soma or the germline (Zhang et al. 2015). Fluorescence microscopy revealed that auxin treatment of degron::GFP::MTR-4 animals that expressed TIR1 in the germline was sufficient to deplete degron::GFP::MTR-4 from the germline but not the soma (Figure 3A). Similarly, in animals expressing TIR1 in the soma, auxin treatment triggered degron::GFP::MTR-4 depletion specifically in the soma (Figure 3B). Germline-specific depletion of MTR-4 depletion caused sterility after 1 day of auxin treatment at 20° (Figure 3C). Soma-specific depletion of MTR-4 caused larval arrest after 1 day of auxin treatment at 20° (Figure 3D). The data confirm that MTR-4 has essential functions in both the soma and germline. Because previous studies (Guang et al. 2010) have shown that nrde-2(−) animals are fertile, and do not show developmental defects, when grown at 20°, the data also show that MTR-4 is likely to have essential biological functions above and beyond that of the NRDE-2/MTR-4 complex. Such a model is consistent with the fact that MTR-4 homologs are components of multiple protein complexes (e.g., TRAMP, NEXT, and PAXT) in other eukaryotes as well as with our observation that MTR-4 and NRDE-2 partially colocalize in C. elegans germ cells (see Figure 2D).
Comments (0)