The interest in using natural killer (NK) cell–based strategies in human cancer immunotherapy has been growing, especially since the development of chimeric antigen receptors (CAR) and the promising development of CAR NK cells (1). The unique abilities of NK cells to precisely recognize and kill tumor cells without requiring prior immunization of the host and with tolerance to healthy cells makes them an attractive tool for treating cancer. Indeed, adoptive transfer of primary NK cells or irradiated NK cell lines, including the NK-92 cell line, has been reported to be feasible and safe in the treatment of patients with advanced malignancies (2). Several cytokine activation-based protocols are in development for ex vivo expansion of human primary NK cells to increase the number and activity of NK cells prior to and, most importantly, after infusion (3). Nevertheless, NK cell–based therapies are not free of certain limitations. Despite clinical responses in some patients, the immunosuppressive tumor microenvironment (TME), an acidified, hypoxic compartment deprived of nutrients, filled with metabolite byproducts, and characterized by chronic oxidative stress, is challenging to overcome for the antitumor activity of NK cells (4).
Oxidative stress is caused by the imbalance between an increased generation of reactive oxygen species (ROS) and their removal by antioxidant defenses. Physiologically, ROS are natural byproducts of aerobic metabolism and are involved in various processes, including the electron transport chain in the mitochondria, gene expression, signal transduction, and activation of transcription factors. Among biologically relevant ROS (1O2, O2•−, H2O2 OH•, ONOO−, HOCl, HOBr), hydrogen peroxide (H2O2) has the highest stability and highest intracellular concentration (5). It undergoes facilitated and regulated diffusion across organelle and plasma membranes through aquaporin (AQP) channel transporters (6). Once transported into the cell, H2O2 can be neutralized by intracellular antioxidant defenses, such as low-molecular-weight thiols—mainly glutathione (GSH)—and various antioxidant enzymes. Catalase (CAT) and glutathione peroxidases (GPX), which catalyze the reduction of H2O2 at the expense of GSH, and peroxiredoxins (PRDX), which are restored to the reduced state by thioredoxins (TXN) and thioredoxin reductases (TXNRD; ref. 7) comprise a major part of the antioxidant defense.
Within the TME, ROS are produced by cancer cells, as well as by immune cells, such as tumor-associated macrophages (TAM), myeloid-derived suppressor cells (MDSC), and neutrophils (8). Increased ROS production by cancer cells, compared with normal tissue, is mainly the result of metabolic alterations, such as increased oxidative phosphorylation in mitochondria (9). Increased ROS, characteristic especially of triple-negative breast cancer cells, are necessary for tumor cell survival (10). In turn, in TAMs, MDSCs, and neutrophils, O2•− and H2O2 are predominantly produced by NADPH oxidase 2 (NOX2; ref. 11) and can be further utilized by peroxidases to generate hypochlorous acid and other oxidants. It has also been shown that H2O2 triggers DNA damage and increased mutagenesis during tumorigenesis (12). Besides promoting oncogenesis, excessive ROS exhibit immunosuppressive activity (13, 14) by inducing NK cell death and impairing NK cell–mediated tumor immunosurveillance (15–18). Several reports demonstrated in tumors an accumulation of CD56bright NK cells, responsible for cytokine production and immune response regulation, at the expense of potent cytotoxic CD56dim NK cells (18, 19). However, the mechanisms explaining the uniquely high sensitivity of NK cells to oxidative stress are not entirely clear.
Therefore, in our study, we aimed to identify and augment deficiencies in NK cells' antioxidative defense system in order to promote their activity in the postinfusion conditions of oxidative stress within the TME. We first performed a comparison of T, B, and NK cells' sensitivities to redox stress and thereafter examined various mechanisms involved in their antioxidant capacities. We identified PRDX1 as a downstream effector of importance for protecting NK cells against oxidative stress. Based on these findings, we generated PD-L1–CAR NK cells and modified them with PRDX1 to enhance their antitumor activity against breast cancer cells. We believe this genetic modification-based strategy may pave the way for more effective NK cell–based therapeutics against solid tumors.
Materials and MethodsCell cultureHuman NK cell lines NK-92 (a generous gift from Prof. Kerry Campbell, Fox Chase Cancer Center, Philadelphia) and NK-92MI (a generous gift from Prof. Daniel Olive, Centre de Recherche en Cancérologie de Marseille, Inserm, U1068, CNRS, UMR7258, Institut Paoli-Calmettes, Aix-Marseille University, UM 105, Marseille, France) were cultured in X-VIVO 20 medium (Lonza) supplemented with 5% human serum (Sigma-Aldrich) and penicillin (100 U/mL) and streptomycin (100 μg/mL; Sigma-Aldrich). For some experiments, the cells were maintained in RPMI-1640 medium (GIBCO) supplemented with 10% heat-inactivated bovine calf serum (HyClone), 2 mmol/L L-glutamine (Sigma-Aldrich), and a mixture of penicillin (100 U/mL) and streptomycin (100 μg/mL; Sigma-Aldrich; further described in the text as the full RPMI-1640). Human breast carcinoma cell lines MCF-7 (86012803) and MDA-MB-231 (92020424) were purchased from the European Collection of Authenticated Cell Culture; SK-BR-3 (HTB-30) was purchased from the American Type Culture Collection (ATCC). The cells were maintained the RPMI-1640 full medium. Chronic myelogenous leukemia cell line K562 (CCL-243) was obtained from ATCC and cultured in the full RPMI-1640 medium. HEK293T (CRL-3216) cells were purchased from ATCC and were cultured in DMEM supplemented with 10% bovine calf serum (HyClone). The murine breast mammary carcinoma 4T1 (CRL-2539), EMT6 (CRL-2755), and EO771 (CRL-3461) cell lines purchased from ATCC were maintained in the full RPMI-1640. Cells were cultured at 37°C, 5% CO2, in a humidified atmosphere. Human cell lines were authenticated using PCR-single-locus-technology (Eurofins Genomics). Cells were maintained in culture for approximately two months during experimental use and were regularly tested for Mycoplasma contamination using the PCR method.
MiceFemale wild-type Balb/c and C57BL/6 mice were purchased from the Animal House of the Polish Academy of Sciences, Mossakowski Medical Research Institute (Warsaw, Poland). NOD.Cg-Prkdc<scid>Il2rg<tm1Wjl>/SzJ (NSG) mice were obtained from the Charles River Laboratories and were bred at the animal facility of the Department of Immunology, Medical University of Warsaw. Randomization of groups was not required in these animal model studies. Experiments were performed at the Animal Facility of the Medical University of Warsaw. Tumor size volume 1,500 mm2 was predetermined as a humane endpoint. During the study, none of the mice experienced unintended discomfort requiring intervention to alleviate the suffering. All in vivo experiments and specific procedures and protocols used for this study were performed in accordance with the guidelines and approved by The Second Local Ethics Committee for the Animal Experimentation, Warsaw University of Life Sciences (number: WAW2/111/2019, WAW2/005/2021, and WAW2/074/2021). The investigator was not blinded when assessing the outcome, as blinding was not relevant to this study.
Tumor model for tumor interstitial fluid collectionTumors were generated in Balb/c (4T1 and EMT6 murine cell lines: 3.5 × 105 cells), C57BL/6 (EO0771 murine cell line: 3.5 × 105 cells), and NSG (MDA-MB-231: 2 × 106 cells; MCF-7: 3 × 106 human cell lines; and 4T1: 3.5 × 105 murine cell line) mice by subcutaneous inoculation of tumor cells in 100 μL of a mixture of PBS:Matrigel Growth Factor Reduced (Corning, LifeSciences; 1:1), on the right flank. MCF-7 cell administration was preceded by subcutaneous implantation of estrogen pellets (17β-ESTRADIOL pellets, 0.36 mg/pellet, Innovative Research of America), 4 days before tumor cell inoculation. MCF-7 cells were injected into the mammary fat pad in 50 μL of a mix of PBS: Matrigel (1:1). Tumors were measured with a caliper, and tumor size was calculated as their surface, according to the formula: (mm2) = (length [mm]) × (width [mm])/2. When one dimension of the tumor reached 15 mm, the tumor was used for tumor insterstitial fluid (TIF) and subcutaneous fluid (SCF) isolation.
Collection of TIF by ultrafiltrationMice were anesthetized by administrating 10 mg ketamine and 1.5 mg xylazine per 100 g body weight. The UF-1-2 In Vivo Ultrafiltration Sampling Probes (BASI, MF-7027) probe was implanted centrally into the tumor masses for two hours to collect tumor secretomes. To extract fluid from the extracellular space of healthy tissue ultrafiltration (UF) probe was implanted under the skin at the opposite side to the tumor location. High-molecular-weight compounds, such as proteins, were excluded from the analytes by a filtration membrane. After ultrafiltration, approximately 10 μL of TIF and 12 to 18 μL of SCF was obtained, and an appropriate volume was used for H2O2 measurement by Hydrogen Peroxide Assay Kit (Abcam; ab102500) according to the manufacturer's specifications.
Blood sampling from miceBefore UF probe implantation, blood was collected by using the submandibular vein method. After a quick puncture of the vein, the blood drops exuded from the puncture point were collected into a tube with EDTA (The Vet-Tube Range). Samples were spin down for 15 minutes at 700 × g, at 25°C, and 100 μL of freshly isolated plasma was placed into a column with a 30 kDa cutoff (Amicon Ultra 0.5 mL Centrifugal Filters, Millipore). After ultrafiltration, approximately 50 μL of the plasma passed through the columns, and an appropriate volume of pure plasma was taken for H2O2 measurement by the Hydrogen Peroxide Assay Kit (Abcam; ab102500).
Tumor immunophenotypingTumors were cut into small pieces and digested for 30 minutes at 37°C using Collagenase type IV (600 U; Sigma-Aldrich), and DNase (400 U; Sigma-Aldrich). Next, tissue fragments were dissociated using a gentleMACS Dissociator and filtered through a 100-μm cell strainer, then washed with PBS containing 2 mmol/L EDTA and 1% FCS, centrifuged, and stained. For staining, cells were blocked in 5% normal rat serum and stained with fluorescently labeled monoclonal antibodies.
Flow cytometry antibodiesFlow-cytometric analyzes were performed using BD LSRFortessa X20 instrument (BD Biosciences), BD FACSCantoII flow cytometer or BD LSR II (BD Biosciences). Data were analyzed with FlowJo (Tree Star). Antibodies to the following mouse proteins were used for flow cytometry: CD45.2 (BD Horizon, clone 104,), CD11b (eBioscience, clone M1/70), Ly6C (eBioscience, clone HK1.4), Ly6G (BioLegend, clone 1A8), CD11c (eBioscience, clone N418), MHC-II (eBioscicence, clone M5/114.15.2), F4/80 (BioLegend, clone BM8), CD4 (eBioscience, clone GK1.5), and CD8a (eBioscience, clone 53-6.7). To assess the live versus dead status of isolated cells, they were stained with Zombie NIR Fixable Viability Kit (BioLegend) according to the manufacturer's protocol.
FACS sortingNK cells were sorted into two major subsets, based on CD56 expression into CD56bright and CD56dim. Briefly, NK cells isolated from peripheral blood mononuclear cells (PBMC) were rested overnight. The next day, NK cells were stained with the following antibodies CD56 (clone AF12-7H3, Miltenyi Biotec) or CD56 (clone R19-760, BD Pharmingen). Cell sorting was performed with FACSAria III cell sorter (BD Biosciences).
ReagentsGlucose oxidase (GOX), sodium L-ascorbate (L-ASC), L-dehydro-ascorbate (L-DHA), and CAT were obtained from Sigma-Aldrich. The reagents were dissolved in sterile distilled water and diluted in a culture medium before an experiment. Torin-1 was purchased from Selleckchem, dissolved in DMSO, and diluted in a culture medium. H2O2 was either ordered from Sigma-Aldrich or H2O2 included in Hydrogen Peroxide Assay Kit (Abcam; ab102500). Trastuzumab (Kanjinti) leftover was donated by patients.
Primary cell isolationHuman primary T cells, B cells, and NK cells were isolated from buffy coats from healthy volunteers obtained from the Regional Blood Center in Warsaw, Poland, with the knowledge of the Bioethics Committee of Medical University of Warsaw, Poland. PBMCs were isolated by density gradient separation using Lymphoprep (STEMCELL Technologies Canada, Inc.). T cells, B cells, and NK cells were isolated using the EasySep Human T-cell Enrichment Kit, EasySep Human B-cell Enrichment Kit, or EasySep Human NK cell Enrichment Kit (STEMCELL Technologies Canada, Inc.) according to the manufacturer's protocols. Primary cells were cultured in full RPMI-1640 medium unless otherwise described for specific experimental procedures.
Primary cell activationFor NK cell stimulation, the cells were seeded at cell density 1 × 106 cells/mL with 10 ng/mL of human recombinant IL15 (Miltenyi Biotec) or with 500 U/mL of human recombinant IL2 (Proleukin; Novartis) and CD2/NKp46 MACSiBead Particles from NK Cell Activation/Expansion Kit (Miltenyi Biotec; 130-094-483). For T-cell activation, the Dynabeads Human T-Activator CD3/CD28 (Thermo Fisher Scientific) simultaneously with 30 U/mL of IL2 were used. B cells were activated by coculture with mitomycin-treated HT1080 cells overexpressing CD40 ligand (CD40L; ref. 20) and 100 ng/mL of IL21 (PeproTech).
Torin-1 treatmentHuman primary T cells, B cells, and NK cells were seeded at the density of 0.5 × 106 cells/mL onto 96-well plates. Torin-1 (final concentration 1 μmol/L) or an equal volume of DMSO (0.1%) was added to the wells. Subsequently, the cells were stimulated with IL15 (10 ng/mL) for 1 and 3 days. NK-92 cells were starved of IL2 for 24 hours before use in an experiment. The cells were seeded onto a 24-well plate at a cell density of 0.25 × 106 cells/mL. Then, Torin-1 or DMSO was added to the wells, and appropriate groups were stimulated with 10 ng/mL of IL15 for 48 hours.
Assessment of cell survival upon prooxidant treatmentHuman primary T cells, B cells, and NK cells were seeded at 0.5 × 106 cells/mL onto 96-well plates (primary cells). H2O2, GOX, L-ASC, L-DHA were added for 16 hours. Subsequently, the viability of the primary cells was assessed by propidium iodide (PI, 1 μg/mL, Sigma-Aldrich) staining, BD Horizon Fixable Viability Stain–FVS510 (BD Biosciences), LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (Thermo Fisher Scientific) or Zombie NIR Fixable Viability Kit (BioLegend). Cells were analyzed using either BD FACSCantoII flow cytometer or BD LSR II (BD Biosciences). To assess the specificity of the cytotoxic effect of H2O2, GOX, and L-ASC on cell viability, the cells were pretreated for 30 minutes with catalase (100 μg/mL) before the addition of the compounds. Viability of mRNA-electroporated human primary NK cells in GOX conditions (16 hours) was assessed with either PI or LIVE/DEAD Fixable Aqua Dead Cell Stain, whereas viability of NK-92MI-mRFP, NK-92MI-PRDX1-mRFP, CAR-PDL-1-NK-92MI-mRFP, and CAR-PD-L1-PRDX1-NK-92MI cell lines after incubation with GOX for 20 hours (0.125 × 106 cells/mL in 48-well plates) was evaluated by FVS510 or ZOMBI NIR staining, and all were analyzed with flow cytometry.
Cell-surface free thiol stainingFree surface thiol groups were determined using the Alexa Fluor 647 C2 Maleimide dye (Thermo Fisher Scientific). Freshly isolated PBMCs were incubated with 5 μmol/L Alexa Fluor 647 C2 Maleimide dye for 15 minutes on ice. The cells were washed and resuspended in staining buffer (PBS supplemented with 2% FBS and 1 mmol/L EDTA) and stained for 20 minutes on ice with the following antibodies: CD56 (clone R19-760, BD Pharmingen), CD3 (SK7, BD Pharmingen), CD19 (SJ25C1, BD Pharmingen), and FVS510. After washing, cells were analyzed on BD FACSCanto II flow cytometer.
Intracellular free thiol stainingIntracellular thiols were assessed with ThiolTracker Violet reagent (Invitrogen). Primary T cells, B cells, and NK cells were seeded onto a U-bottom 96-well plate at a cell density of 0.5 × 106 cells/mL and were rested overnight. The next day cells were stained with 2 μmol/L of ThiolTracker Violet reagent at 37°C and 5% CO2 for 30 minutes. Subsequently, the cells were washed in PBS and analyzed on BD LSRFortessa X20 instrument (BD Biosciences) and HTS sampler. The experiment was performed in two technical replicates for every donor.
Assessment of H2O2 concentration in mediumDifferent concentrations of GOX were added to the full RPMI-1640 in a U-bottom 96-well plate and were incubated for 4 hours. H2O2 concentration in the medium was measured using the Hydrogen Peroxide Assay Kit (Abcam) according to the manufacturer's protocol. Briefly, 50 μL of H2O2 standards were plated in a black 96-well flat bottom plate with a transparent bottom. The GOX-treated medium (20–30 μL) was aspirated and diluted in assay buffer and added to the wells. Thereafter, OxiRed/HRP mix diluted in assay buffer was added to the wells and incubated for 10 minutes at room temperature. Both fluorimetric (EnVision, PerkinElmer) and colorimetric readout (ASYS UVM340 Microplate Reader) were taken.
Detection of intracellular ROSPrimary T, B, and NK cell subpopulations were incubated with 1 μmol/L CM-H2-DCFDA fluorescent probe (Molecular Probes) in PBS at 37°C and 5% CO2 for 30 minutes and then washed with the culture medium. Next, the cells were seeded onto U-bottom 96-well plates at a cell density of 5×105 cells/mL and incubated with 5 or 10 μmol/L H2O2 for 1 hour. To determine the intracellular ROS concentration, the cells were analyzed using BD FACSCantoII flow cytometer (BD Biosciences). Results were shown as geometric mean fluorescence intensity of oxidized CM-H2-DCFDA. For the CellROX Deep Red and CellROX Green assays (Thermo Fisher Scientific), resting T, B, and NK cells were seeded onto U-bottom 96-well plates at the density of 5×105 cells/mL and incubated with 5 or 10 μmol/L H2O2 for 1 hour. Subsequently, the CellROX Deep Red/CellROX Green reagent was added to the cells and the staining was performed at 37°C, 5% CO2 for 30 minutes. After washing, the cells were analyzed on BD LSRFortessa X20 instrument (BD Biosciences).
Real-time cell analysis cytotoxicity assayThe cytotoxicity of NK cells was assessed with a real-time cell analysis (RTCA) assay. Adherent target MCF-7 (3 × 104 cells/well), MDA-MB-231 (3 × 104 cells/well), or SK-BR-3 (4 × 104 cells/well) cells were seeded onto 16-well E-Plates (ACEA Biosciences) in 150 μL of standard RPMI-1640 full medium. For nonadherent K562 cells, 16-well E-Plates were precoated with the Liquid Tumor Killing Assay (anti-CD71) Tethering Kit (ACEA Biosciences) according to the manufacturer's recommendations. K562 cells were seeded onto 16-well E-Plates at a cell density of 1.5 × 104 cells/well. The proliferation of target cells was monitored in the incubator at 37°C (5% CO2, 95% humidity) for 24 hours with the xCELLigence impedance-based RTCA system (Acea Biosciences). The next day, 100 μL of the medium was aspirated and replaced with the medium containing effector cells (human primary NK cells or NK-92 cell lines) at different effector to target (E:T) ratios. For antibody-dependent cell cytotoxicity (ADCC) assays, trastuzumab (anti-HER2 antibody) was added to appropriate wells at a final concentration of 10 μg/mL. The cells were monitored for the next 20 to 24 hours. Analysis was performed using RTCA Software Pro (ACEA Biosciences). The impedance changes (cell index) were normalized to the end value of the target cells' proliferation and plotted over time as normalized cell index.
RNA isolation and quantitative real-time PCRTotal RNA from primary cells was isolated with the use of either the High Pure RNA Isolation Kit (Roche Diagnostics) or RNase Mini Kit (Qiagen) with QIAshredder (Qiagen) used for homogenization of cells lysates according to the manufacturer's recommendation. The concentration of isolated RNA was measured with the spectrophotometer NanoDrop 2000 (Thermo Scientific). In each experiment, equal amounts of RNA (from 200 ng to 500 ng) were used for reverse transcription (RT) to complementary cDNA using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific). RT reaction was performed according to the manufacturer's recommendations. Briefly, random hexamers annealing was performed at 65°C for 5 minutes and cooled on ice. Then RT reaction mix was preincubated with annealed RNA at room temperature for 10 minutes and incubated at 55°C for 10 minutes, followed by enzyme inactivation at 80°C for 10 minutes. Quantitative real-time PCR (qPCR) was performed using LightCycler 480 SYBR Green I Master (Roche Diagnostics) and LightCycler 480 II device (Roche Diagnostics). The qPCR temperature cycling conditions were as follows: initial denaturation at 95°C for 5 minutes, 45 standard amplification cycles of denaturation at 95°C for 10 seconds, primer annealing at 60°C for 10 seconds, and primer extension at 72°C for 10 seconds, followed by melting curve analysis (95°C for 5 seconds, 65°C for 1 minute 97°C continuous) and cooling at 40°C for 30 seconds. Samples were measured in duplicates in each PCR run. RPL29 (ribosomal protein L29) and β-2-microglobulin were used as reference genes. Sequences of all primers used in qPCR are presented in Table 1. For the assessment of aquaporin 3 (AQP3) and aquaporin 11 (AQP11) in primary human NK, T, and B cells, the TagMan assays were used. The qRT-PCR was performed with TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific) and the following TaqMan Gene-Expression Assays: AQP3 (Hs00185020_m1) and AQP11 (Hs00542682_m1) according to the manufacturer's recommendations. For the reference gene, GAPDH (Hs02786624_g1) was used.
Table 1.List and sequences of all primers used in qPCR.
Western blottingFor Western blotting (WB), cells were lysed with lysis buffer (50 mmol/L Hepes, 150 mmol/L NaCl, 5 mmol/L EDTA, 1% Triton X-100, 10% glycerol, pH 7.4) or Cell Lysis Buffer (Cell Signaling Technology) supplemented with Complete Protease Inhibitor Cocktail and Phosphatase Inhibitor Cocktail (Roche Diagnostics). Protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer's instructions with minor modifications on the ASYS UVM340 Microplate Reader (Biochrom). Cell lysates (15–30 μg) were separated in 12% polyacrylamide gel, then transferred onto Protean nitrocellulose membranes and blocked with either 5% nonfat milk or 5% Bovine Serum Abumine (Kenilworth) in TBST (Tris-buffered saline, pH 7.4 and 0.05% Tween 20) and then incubated with the following primary antibodies PRDX1 (catalog number HPA007730, Sigma-Aldrich; dilution 1:1,000), TXN1 (2429, Cell Signaling Technology; dilution 1:1,000), GPX1 (3206, Cell Signaling Technology dilution 1:1,000), CAT (12980, Cell Signaling Technology; dilution 1:1,000), SOD1 (2770, Cell Signaling Technology; dilution 1:1,000), and β-actin (A222, Sigma-Aldrich; dilution 1:50,000). For detection of primary protein bands, HRP-conjugated secondary antibodies and the Super Signal chemiluminescent substrates (Thermo Fisher Scientific) were used. The signal was detected using the ChemiDoc Imaging System (Bio-Rad Laboratories). Densitometry of WBs was calculated using the Image Lab Software (Bio-Rad Laboratories).
CAR constructsThe anti-CD19 CAR construct was a generous gift from Dr. Jon-Amund Kyte from Oslo University Hospital under the MTA agreement. The construct comprises an anti-CD19 single-chain fragment variable fragment (scFv) derived from the FMC63 mouse hybridoma, an IgG1-CH2CH3 spacer region, and the two costimulatory domains CD28 and OX40 and was subcloned into the mRNA expression vector pCIpA102. The anti–PD-L1 CAR was synthesized by Creative Biolabs. The scFv is based on the atezolizumab sequence and was combined with a second-generation CAR backbone comprised of IgG4 hinge region, CD28 transmembrane and signaling portions, and CD3ζ signaling domain. PD-L1 CAR was cloned into the BamHI/SbfI restriction sites of the lentiviral transfer plasmid pSEW (21), thereby replacing the gfp gene. CAR expression in the cells, after transduction or electroporation was assessed with AF647 goat anti-human IgG, F(ab')2 fragment specific antibody (cat. no. 109-605-006, Jackson Immuno-Research Europe Ltd.) or AF647 goat anti-human IgG Fcγ fragment–specific antibody, for PD-L1 CAR (cat. no. 109-606-098 Jackson Immuno-Research Europe Ltd.).
mRNA synthesismRNA for PRDX1 and CAR-CD19 was synthesized in vitro with the use of the RiboMAX Large-Scale RNA Production System (Promega). The PRDX1 coding sequence was subcloned from PRDX1-pETMM11 plasmid to mRNA expression vector pCIpA102 (kindly provided by Dr. Stein Sæbøe-Larssen from Oslo University Hospital) with the use of FastDigest EcoRI and NotI restriction enzymes (Thermo Fisher Scientific). pCIpA102 plasmid containing CAR-CD19 coding sequence was kindly provided by Dr. Jon Amund Kyte Oslo University Hospital under MTA. Both plasmids pCIpA102-PRDX1 and pCIpA102-CAR-CD19 were linearized with MfeI restriction enzyme (New England BioLabs) and used for the mRNA synthesis reaction. Anti-Reverse Cap Analog (Trilink Biotechnologies) was used to cap the mRNA. The synthesis reaction was carried out for 4 hours at 37°C. Then, RNA-free DNase was added to digest the residual DNA matrix. The synthesized mRNA was then purified using either the MEGAclear Transcription Clean-Up Kit (Thermo Fisher Scientific) or the lithium chloride (LiCl; Thermo Fisher Scientific) precipitation method. The mRNA's quality and quantity were assessed by agarose gel electrophoresis and NanoDrop (Thermo Scientific).
mRNA electroporationFor mRNA electroporation, primary NK cells were cultured in SCGM medium (CellGenix) supplemented with 5% human serum and the mixture of antibiotics for 3 days in the presence of IL15 (10 ng/mL). After that, NK cells were washed and resuspended in serum and antibiotics-free SCGM medium at a cell density of 10–15 × 106 cells/mL. mRNA was mixed with the cell suspension at the final mRNA concentration of 100 mg/mL. Subsequently, the cell suspension was placed in a 4-mm gap cuvette and electroporated with 500 V for 2 ms using a BTX 830 Square Wave Electroporator (BTX Technologies) or Gene Pulser Xcell (Bio-Rad) and square wave settings. After electroporation, cells were immediately transferred to a prewarmed culture medium supplemented with 5% human serum and IL15 (10 ng/mL) and then cultured overnight. NK-92MI cells were electroporated using Gene Pulser Xcell electroporator (Bio-Rad). The cells were placed in a 4-mm gap cuvette in 250 μL of empty RPMI-1640 and electroporated with 300 V, 150 μF, 200 Ω. After electroporation, cells were transferred to prewarmed RPMI supplemented with 10% FCS.
Generation of NK-92 cells stably overexpressing PRDX1PRDX1 overexpression was done in NK-92MI using a lentiviral transduction system. The original plasmid HIV-SFFV-mRFP-WPRE CORRIGE (a kind gift from Prof. Els Verhoeyen, University of Lyon) was modified by replacing the mRFP with the MCS-IRES-mRFP sequence. The PRDX1 sequence was amplified by PCR from PRDX1-pETMM11 plasmid and cloned into MCS (multicloning site) by ligation into BamHI and MluI sites (FastDigest Thermo Fisher Scientific). The sequence of the construct (HIV-SFFV-PRDX1-IRES-mRFP) was confirmed by DNA sequencing. NK-92MI cells were modified with lentiviral transduction, as described below. After transduction, cells were sorted based on mRFP fluorescence. The sorting was performed with FACSAria III cell sorter (BD Biosciences). The overexpression of PRDX1 was confirmed by WB. NK-92MI cells modified with empty plasmid HIV-SFFV-IRES-mRFP are referred to NK-92MI-mRFP cells, whereas NK-92MI cells with PRDX1 overexpression (HIV-SFFV-PRDX1-IRES-mRFP) are referred to NK-92MI-PRDX1-mRFP.
Generation of NK-92 cells stably expressing luciferaseThe NK-92 cell line was modified using the plasmid (pSLIEW-luc-GFP kindly provided by Prof. Olaf Heidenreich; ref. 22) allowing cells to express both firefly luciferase and eGFP. eGFP-positive cells were sorted with FACSAria III cell sorter (BD Biosciences).
In vivo imaging of NK-92MI cells overexpressing luciferase in the tumorTen days after tumor cell inoculation, mice received 5.0 × 106 of either NK-92MI-mRFP-pSLIEW-luc cells or NK-92MI-PRDX1-mRFP-pSLIEW-luc cells intratumorally. Immediately following the injection of NK-92MI cells, bioluminescence imaging (BLI) was performed with 100 μL of d-luciferin (Syd Labs; 150 mg luciferin/kg body weight). The NK cell imaging was performed using the IVIS Imaging System (Xenogen). Images were analyzed with the Living Image 4.3 software package (Caliper Life Science). To quantify the BLI signal of NK-92MI cells, the regions of interest were drawn on the tumor region, and the results were used to generate the BLI data presented as total flux (photons/second).
Luciferase-based in vitro proliferation of NK-92MI cellsNK-92MI-mRFP and NK-92MI-PRDX1-mRFP cells previously modified to overexpress firefly luciferase were seeded at a cell density of 5 × 104/mL onto a 12-well plate in the full RPMI medium. Every day the cells were resuspended and 100 μL of the cell suspension was aspirated and transferred onto a new black 96-well black plates with a clear bottom (PerkinElmer). Subsequently, 100 μL of Bright-Glo Luciferase Assay System (cat. No. E2610, Promega) was added to the wells and the plate was incubated for 5 minutes in darkness, then the bioluminescence signal was measured using Victor Plate Reader (PerkinElmer). Cell proliferation was monitored for 7 days.
PD-L1 knockout in MDA-MB-231 cellsLentiviral plasmid lentiCRISPR v2 containing the sequences encoding Cas9 nuclease and the single guide RNA (sgRNA) scaffold was a gift from Feng Zhang (Addgene, #52961). The sgRNA sequence targeting human PD-L1 (ACATGTCAGTTCATGTTCAG) was selected from the Human CRISPR Knockout Pooled Library Brunello database and subcloned into the lentiCRISPR v2 vector using a pair of oligonucleotides:
As a control, lentiCRISPR v2 plasmid with a nontargeting sgRNA sequence sgNTC (ACGGAGGCTAAGCGTCGCAA) was used. After the viral transduction, the modified MDA-MB-231 cells were selected based on their antibiotic resistance to puromycin delivered by lentiCRISPR v2 vector. Surface PD-L1 expression was evaluated by flow cytometry using anti–PD-L1 clone MIH1 (Thermo Fisher Scientific #17-5983-42, dilution 1:100).
NK-92 infiltration into tumorsTo evaluate NK cell infiltration into tumors, a previously established three-dimensional (3D) lung tumor model (23) was used that recapitulates the immunosuppressive characteristics of lung tumors in vivo. The 3D models were engineered from poly(ethylene glycol) (PEG)-based hydrogels functionalized with both cell-adhesive and enzymatically degradable peptides as described previously (23). Briefly, 10 million cells/mL DiO-labeled A549 human lung cancer cells (ATCC) were photoencapsulated in 10 μL of the PEG-based precursor solution dissolved in PBS with 0.05% (v/v) Irgacure 2959 (photoinitiator). The hydrogel precursor solution contained a 50:50 ratio of 10% (w/v) PEG-diacrylate (Laysan Bio Inc) and 10% (w/v) PEG functionalized with matrix metalloproteinase (MMP) degradable sites (sequence GGVPMS↓MRGGK, Biomatik), and 5 mmol/L of PEG functionalized with cell adhesion sites (arginine-glycine-aspartic acid, RGD, Vivitide). The 3D models were polymerized by OmniCure S2000 light (Excelitas Technologies, Corp.) for 3 minutes using 4 mW/cm2 long wave A (UVA) light. After polymerization, the models were cultured in RPMI-1640 with 10% (v/v) fetal bovine serum, 1% (v/v) L-glutamine, and 1% (v/v) penicillin streptomycin for 1 or 7 days.
On days 1 and 7 of culture, DiI labeled control (mRFP) or PRDX1 overexpressing (PRDX1-mRFP) NK-92MI cells were incubated with the 3D culture systems at a 2:1 E:T-cell ratio in RPMI-1640 with 10% (v/v) fetal bovine serum, 1% (v/v) L-glutamine, and 1% (v/v) penicillin–streptomycin on a shaker. After two hours of coculture, the media were removed, the 3D models were rinsed in PBS, and fixed in 10% neutral buffered formalin. The 3D models were moved to a glass dish and imaged with confocal microscopy (Zeiss LSM 880, Carl Zeiss). The images were evaluated for NK cell and cancer cell fluorescent intensity and extent of colocalization of NK cells with cancer cells by the Mander's overlap coefficient (24) using Fiji (NIH).
Lentiviral transductionFor lentiviral transduction, either the standard calcium phosphate method or a polyethyleneimine (PEI) transfection protocol were used. Briefly, 2.6 × 106 HEK293T cells were seeded onto a 10-cm tissue culture dish. The next day, the cells were cotransfected with 8.6 μg of a plasmid containing the gene of interest (SFFV-PRDX1-mRFP, pSEW-CAR-PD-L1, pSLIEW-luc-GFP, or lentiCRISPRv2-sgPDL1), 8.6 μg psPAX2 packaging vector (cat. no. 12260, Addgene), and 5.5 μg pMD2.G envelope vector (cat. no. 12259, Addgene). 48 hours posttransfection, the lentivirus-containing medium was collected, filtrated through a 0.45-μm filter, and centrifuged overnight at 3,500 × g at 4°C. The next day, target cells were transduced with the concentrated lentivirus-containing medium. For transfection, target NK-92 and NK-92MI cell lines were resuspended in X-VIVO 20 medium with 5% human serum and IL2 (200 U/mL) supplemented with protamine sulfate (final concentration 15 μg/mL) and BX795 inhibitor (final concentration 6 μmol/L). Cells (2.5 × 105) were transferred to a 50 or 15 mL Falcon tube, and concentrated viral supernatant was added to the cell suspension. The cells with the lentivirus were centrifuged for 1 hour at 750 × g at 32°C, then transferred to a 24-well plate and incubated for 24 hours. The next day, all procedures were repeated with a new portion of lentiviral supernatant.
Statistical analysisStatistical analysis was performed with GraphPad Prism 7 (GraphPad Software). For paired sample sizes n ≥ 5, statistical analysis was done using the Wilcoxon test. For unpaired samples (n ≥ 5), the Mann–Whitney test or unpaired t test were used. For statistical comparison between more than two groups, two-way ANOVA with post hoc analysis was used. For RNA-sequencing (RNA-seq) data, statistical comparison between groups was done with one-way ANOVA. Particular group means were compared using unpaired t test. Data were considered significant when *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001. Only statistically significant differences were marked on the graphs. For low sample sizes n < 5, individual data points depict technical replicates, particular measurements, or averages of two technical replicates. Statistical tests are described in detail in figure legends.
RNA-seq dataPublic RNA-seq data from four experiments (E-GEOD-60424, E-GEOD-83808, E-GEOD-83115, and E-GEOD-62920) involving either B, T, or NK cells from healthy donors were analyzed. In the case of the E-GEOD-60424 data set, all selected samples had data for all the above-mentioned cell types, whereas E-GEOD-83808 RNA-seq analysis was performed for three healthy patients and involved various subpopulations of T cells, E-GEOD-83115 collected data for B cells and T cells from a single patient (with replicates obtained by sequencing samples at two independent sites), and E-GEOD-62920 included gene-expression for T cells from a single individual. Experiment IDs, as well as cell types and sample IDs are provided in Supplementary Table S1. Read quality was assessed with FastQC (ref. 25; version 0.11.9). Sickle (version 1.33) was used to trim reads fragments with an average quality below 30 in Phred scale and to filter out reads shorter than 40 bp. Processed reads were mapped onto the human GRCh38 reference genome (downloaded from the UCSC database) using STAR (ref. 26; version 2.7.3a). Samtools (ref. 27; version 1.9) was used to keep only reads with flags 99, 147, 83, or 163 and mapping quality 255. Reads associated with human genes, as defined in the Gencode GTF annotation file V29, were selected using featureCounts function from the RSubRead package (ref. 28; version 1.6.4). As the aggregated data come from different experiments and sequencing platforms, to remove batch effects ComBat from SVA package (29) was used (version 3.34). In downstream analyses, samples were divided into three groups: B, T, and NK cells, even if additional information allowed them to be assigned to a more specific subpopulation of cells. All plots were prepared using the ggplot2 package (ref. 30; version 3.3). R script, phenotype file required by ComBat and text file with commands used in this analysis are available at https://github.com/michallaz/RNASeq_immunnology.
Polysome RNA-seq data of NK cells stimulated with IL15 and IL2Public RNA-seq data (GSE77808) from six donors were analyzed. For each donor, four polysome mRNA samples of stimulated NK cells were analyzed: (i) IL2 activated, (ii) IL2 activated followed by withdrawal after 48 hours, (iii) IL15 activated, and (iv) IL15 activated followed by withdrawal after 48 hours. Due to low quality of RNA obtained for some samples, Donor 3 contains activation and withdrawal data pooled from two different donors. Read quality was assessed with FastQC. Reads were mapped onto the human GRCh38 reference genome (downloaded from the UCSC database) using STAR (ref. 26; version 2.7.3a). Filtering properly and uniquely mapped reads (with flags 99, 147, 83, or 163) was done using Samtools (27). Exonic gene expression for human genes annotated in the Gencode GTF annotation file V35 was calculated using HTSeq-count (31). Raw gene counts were normalized using TMM method implemented in edgeR package (32, 33) and the final expression was calculated as Counts Per Million (CPM). R script and text file with commands used in this analysis are available at https://github.com/michallaz/RNASeq_immunnology.
ResultsTumors are characterized by increased ROS and redox imbalanceAlthough elevated ROS are described as a characteristic element of cancer, there are limited data on concentrations of H2O2 within the TME. Therefore, we measured H2O2 concentrations in breast cancer TIF, a fluid phase representing the tissue microenvironment. Semipermeable membranes were implanted within the tumor masses of subcutaneous 4T1, EMT6, or EO771 murine syngeneic breast cancer models, and then by in vivo ultrafiltration, extracellular fluid bathing the tumor, stroma, and immune cells was extracted. The concentrations of H2O2 measured in the TIF reached approximately 10 μmol/L in all three tested cell lines, whereas in control fluids isolated either from peripheral blood or subcutaneously implanted membranes (SCF), H2O2 was present in undetectable or significantly lower amounts (Fig. 1). Immunophenotyping of the 4T1 tumors revealed CD45+ immune cell infiltration into the tumor site, with a dominant population of immature myeloid cells (Supplementary Fig. S1A and S1B), which has been shown to be a cellular source of ROS in the immunosuppressive microenvironment of the tumor (12). We concluded that effector immune cells are exposed to elevated H2O2 in tumor tissue fluids upon infiltration into the tumor site.

Figure 1. Detection of H2O2 in the TME. H2O2 concentrations in blood, subcutaneous fluid (SCF), and TIF collected via ultrafiltration from 4T1, EMT6, and EO771 tumors. Bars represent median with range; dots represent individual mice, n = 4–5 (SCF and TIF), n = 2–3 (blood). Statistic: Mann–Whitney test.
NK cells are particularly susceptible to oxidative stressWe next determined the sensitivity of different lymphocyte subpopulations to redox stress induced by H2O2. We isolated human primary NK, T, and B cells from peripheral blood of healthy donors, incubated them with increasing concentrations of hydrogen peroxide (H2O2) or glucose oxidase (GOX) and determined cell viability with PI staining. GOX was used as an enzyme that generates H2O2 by oxidation of glucose to D-glucono-δ-lactone. First, to estimate the GOX doses that generate H2O2 concentrations similar to those observed in vivo, we measured H2O2 produced by GOX in the culture medium in vitro. We observed that GOX within a range of 0.25–0.5 mU/mL produced approximately 10 μmol/L H2O2 (Fig. 2A), and therefore these concentrations of GOX were used in our subsequent experiments.

Figure 2. The sensitivity of human primary T, B, and NK cells to oxidative stress. A, H2O2 generated by GOX after 4 hours (n = 3–6). Bars represent median with range, dots represent average of two technical replicates. Statistic: Mann–Whitney test. B–E, Survival of T, B and NK cells after 16 hour-incubation with H2O2 (B; n = 7), GOX (C; n = 5), sodium ascorbate (D; n = 8), and L-dehydroascorbate (E; n = 7), measured by viability staining and flow cytometry. Data shown as mean ± SD. Statistic: two-way ANOVA (P < 0.0001), followed by Dunnett post hoc test in comparison with NK cells. Statistically significant differences between NK cells and B cells (red stars), and NK cells and T cells (blue stars). F–H, NK cell survival after 16 hours of incubation with H2O2 (F), GOX (G), and sodium ascorbate (H) in the presence/absence of CAT (n = 3). Data shown as mean ± SD; n = 3. Statistic: two-way ANOVA, P < 0.0001.
We observed that among lymphocytes isolated from several healthy donors, NK cells are the most sensitive to H2O2 and GOX compared with T cells and B cells (Fig. 2B and C). Significant differences between populations were observed in concentrations as low as 0.125 mU/mL GOX and 6.25 μmol/L of H2O2, which correspond to concentrations achievable in murine tumors models in vivo. Consistent with previous reports, we also observed that CD56bright cells were more resistant to redox stress in comparison with CD56dim NK cells (Supplementary Fig. S1C; ref. 18). Correspondingly, sodium L-ascorbate (L-ASC), previously demonstrated to generate H2O2 in serum-containing culture medium (34), exerted the most pronounced cytotoxic effect against NK cells compared with T and B cells (Fig. 2D). Moreover, L-dehydro-ascorbate (L-DHA), an oxidized form of L-ASC that does not generate H2O2, was not toxic to NK cells (Fig. 2E). Cells were then treated with increasing concentrations of H2O2, GOX, and L-ASC in the presence of catalase (CAT), an H2O2 scavenger, and their toxicity was entirely reversed by incubation with CAT (Fig. 2F–H), further confirming the dominant role of H2O2 in the induction of cell death.
Redox stress impairs the cytotoxic activity of NK cellsTo investigate how redox stress influences NK cells' functions, we isolated NK cells from peripheral blood of healthy donors and incubated them with increasing concentrations of GOX. The potential of NK cells to kill target tumor cells was assessed by the RTCA, an impedance-based technology used for label-free and real-time monitoring of cytotoxicity. We observed that GOX impairs the ability of NK cells to kill target K562 cells via the natural cytotoxicity mechanism in a dose-dependent manner (Fig. 3A), as well as in the ADCC mechanism induced by trastuzumab against HER2-positive MCF-7 (Fig. 3B) and SK-BR-3 cell lines (Supplementary Fig. S2). We confirmed NK-mediated ADCC in the absence of trastuzumab for both MCF-7 (Supplementary Fig. S3A) and SK-BR3 (Supplementary Fig. S3B) cell lines. Altogether, these results provided direct evidence that redox stress induced by H2O2 impairs the antitumor activity of NK cells.

Figure 3. RTCA analysis of resting human primary NK cell cytotoxicity in the oxidative stress conditions generated by GOX. Natural cytotoxicity of human primary NK cells toward K562 targets (A) or trastuzumab-dependent cell-mediated cytotoxicity of human primary NK cells against MCF-7 targets (B; E:T ratio 1:1, 2:1, 5:1) as measured by RTCA. Left, representative experiment from one donor. Data shown as averages ± SD from two technical replicates. Right, data of three independent experiments (19 hours after the effectors' addition) presented as median with range. Dots represent average of two technical replicates.
The scavenging potential of thiols and H2O2 transport ability does not explain the high susceptibility of NK cells to redox stressTo further explore the molecular basis for the high sensitivity of NK cells to redox stress, we performed experiments determining the H2O2 transport capability and antioxidative capacity of T, B, and NK cells. We determined the concentrations of both extracellular and intracellular free thiols to estimate the H2O2 scavenging potential of lymphocytes. Extracellular cell-surface-free thiols (CSFT) in T, B, and NK cells were analyzed by staining with the maleimide derivative of Alexa Fluor 647 dye. We observed the highest level of CSFT in B cells, whereas T cells and NK cells were characterized by lower CSFT (Supplementary Fig. S4A). Within the NK cell population, we observed increased CSFT in the CD56bright subpopulation, comparable with those observed in B cells and significantly higher than in CD56dim cells (Supplementary Fig. S4B), which was in accordance with a previous study (18). Furthermore, with ThiolTracker Violet probe, we found that reduced GSH, representing the majority of intracellular free thiols, was the highest in NK cells when compared with T and B cells (Supplementary Fig. S4C). This does not, however, explain the sensitivity of NK cells to redox stress. Therefore, we compared the H2O2 transport capacity between the selected lymphocyte subpopulations. Although H2O2 has been long believed to cross cell membranes freely, several recent studies point out that mammalian membranes are relatively poorly permeable to H2O2 (6, 35). Today, it is widely accepted that aquaporins promote the transport of water and H2O2 as diffusion-facilitating channel proteins (6). To determine the expression of various aquaporins in different lymphocyte subsets, we performed RNA-seq analysis of publicly available data (Supplementary Table S1). In our analysis of T, B, and NK cells, we only detected the expression of AQP3 and AQP11; however, AQP11 expression was very low (Supplementary Fig. S4D). AQP3 expression, although similar in both B cells and NK cells, was significantly higher in T cells (Supplementary Fig. S4D). We further confirmed these findings by qRT-PCR in lymphocytes isolated from healthy donors (Supplementary Fig. S4E). In summary, these data show that the high susceptibility of NK cells to redox stress is not the result of low extra/intracellular free thiol scavenging activity or increased ability to transport H2O2 through the membrane.
We next assessed ROS concentrations in T, B, and NK cells, at steady state and in response to H2O2. We observed similar CM-H2-DCFDA staining in NK, T, and B cells, which was further increased upon incubation with H2O2 (Supplementary Fig. S4F). Although CM-H2-DCFDA is the most widely used probe for detecting intracellular ROS, CM-H2-DCFDA is a thiol-reactive probe, and its fluorescence cannot be used as a direct measure of H2O2 (36). Therefore, we also performed stainings with CellROX Reagents, namely, CellROX Deep Red, for ROS localized primarily in the cytoplasm and mitochondria, and CellROX Green, a nucleic acid binding dye, for ROS localized in the nucleus (37). Consistent with previous observations (38), CD56bright cells accumulated less ROS when compared with CD56dim cells, as determined by CellROX Deep Red (Supplementary Fig. S4G). However, in comparison with T and B cells, bulk NK cells were characterized by the lowest basal cytoplasmic ROS concentration (Supplementary Fig. S4H) and comparable nuclear ROS concentration (Supplementary Fig. S4I). Nonetheless, upon incubation with H2O
Comments (0)