AZ628 (HY-11004), tovorafenib (HY-15246), cobimetinib (HY-13064), binimetinib (HY-15202), CH5126766 (HY-18652), trametinib (HY-10999), encorafenib (HY-15605) and GDC-0623 (HY-15610) were obtained from MedChemExpress. Danoprevir was obtained from ApexBio (A4024). A-1155463 was obtained from ChemieTek (CT-A115). LXH-254 (S8745) and vemurafenib (S1267) were obtained from Selleck Chemicals. Compound 15 (3,4-difluoro-2-[(2-fluoro-4-iodophenyl)amino]-N-(2-hydroxyethoxy)benzamide) was obtained from AABlocks (AA01EMTY). We verified that commercial inhibitors were >98% pure by liquid chromatography–mass spectrometry (LC–MS) analysis (200–352 nm).
AntibodiesThe following antibodies were used: MEK1 61B12 mouse monoclonal antibody (mAb; Cell Signaling Technology, 2352; 1:500 dilution), phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology, 4370; 1:1,000 dilution), p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology, 9107; 1:1,000 dilution), phospho-MEK1/2 (S217/S221) (41G9) rabbit mAb (Cell Signaling Technology, 9154), C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology, 53745; 1:1,000 dilution), phospho-C-RAF (S338) (56A6) rabbit mAb (Cell Signaling Technology, 9427; 1:1,000 dilution), phospho-C-RAF (S259) antibody (Cell Signaling Technology, 9421; 1:1,000 dilution), phospho-C-RAF (S289/S296/S301) antibody (Cell Signaling Technology, 9431; 1:1,000 dilution), phospho-B-RAF (S445) antibody (Cell Signaling Technology, 2696; 1:1,000 dilution), phospho-C-RAF (S621) polyclonal antibody (Invitrogen, 44-504G; 1:500 dilution), protein A agarose beads (Cell Signaling Technology, 9863), protein G agarose beads (Cell Signaling Technology, 37478), 14-3-3 (pan) E9S9M rabbit mAb (Cell Signaling Technology, 95422; 1:1,000 dilution), B-RAF antibody (F-7) (Santa Cruz Biotechnology, 5284; 1:200 dilution), anti-phospho-B-RAF (T401) antibody produced in rabbit (Sigma-Aldrich, SAB5701867; 1:1,000 dilution), A-RAF antibody (A-5) (Santa Cruz Biotechnology, 166771; 1:200 dilution), anti-MEK1 antibody (Sigma-Aldrich, 07-641; 1:500 dilution), purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences, 610122; 1:500 dilution), GAPDH antibody (A-3) (Santa Cruz Biotechnology, 137179; 1:2,000 dilution), mouse IgG2a isotype control (PPV-04) (Thermo Scientific, Invitrogen, MA1-10418), normal rabbit IgG (Sigma-Aldrich, 12-370), IRDye 680RD goat anti-mouse IgG secondary antibody (LI-COR Biosciences, 926-68070; 1:10,000 dilution), IRDye 800CW goat anti-rabbit IgG secondary antibody (LI-COR Biosciences, 926-32211; 1:10,000 dilution) and Pierce anti-HA magnetic beads (Thermo Fisher Scientific, 88836).
PlasmidsAll plasmids were constructed using Gibson assembly and standard protocols and then validated through Sanger or whole-plasmid sequencing. The following primers were used:
B-RAF WT: CGTCGTCAGGATCATCGCCCTTAAGCTTGCCGCCACCatgggaTAT, AACGGGCCCTCTAGATGCATGCTCGAGtcagtggacaggaaacgcaccat;
B-RAF-G615R: CGTCGTCAGGATCATCGCCCTTAAGCTTGCCGCCACCatgggaTAT, AACGGGCCCTCTAGATGCATGCTCGAGtcagtggacaggaaacgcaccat, ccatcagtttgaacagttgtctCGAtccattttgtggatggcac agacaactgttcaaactgatgg;
TurboID–KRAS TurboID fragment: atggaacaaaaactcatctcagaagaggatctcggtggaaaagacaatactgtgcctct, AGCCAGATCCactaccgctgccaccctgcagcttttcggcag;
TurboID–KRAS KRAS fragment: agcggtagtGGATCTGGCTCAGGAatgactgaatataaacttgtggtagttg, GTTTAAACGGGCCCTCTAGACTCGAGttacataattacacactttgtctttgact.
Cell cultureAll cancer cell lines used in this study, namely Mia PaCa-2 (CRL-1420), MDA-MB-453 (HTB-131), SW-480 (CCL-228), DLD-1 (CCL-221), MDA-MB-231 (HTB-26), HCT-116 (CCL-247), LoVo (CCL-229), HPAF-II (CRL-1997), AsPc-1 (CRL-1682), A549 (CCL-185) and Calu-6 (HTB-56) were purchased from the American Type Culture collection (ATCC) and cultured in DMEM (Thermo Fisher) + 10% FBS (Millipore Sigma), with the exception of HCT-116 cells, which were cultured in McCoy’s medium (Thermo Fisher) supplemented with 10% FBS. All cell lines were authenticated by ATCC through short tandem repeat profiling. All cell lines were maintained at 37 °C with 5% CO2. CIAR-293 expressing cell lines were generated as previously described33,52.
SDS–PAGE and western blottingGel-ready samples were quickly centrifuged and loaded onto any-kDa SDS–PAGE gels (Bio-Rad). Then, 2 µl of PAGEruler Plus prestained protein ladder (Thermo Scientific) was loaded onto each gel. SDS–PAGE was performed at 200 V for 40 min. Gels were then placed into Trans-Blot Turbo nitrocellulose midi transfer packs (Bio-Rad) and loaded into a Trans-Blot Turbo (Bio-Rad) before performing protein transfer (16 V, 14 min). Membranes were then incubated in blocking buffer (5% dry milk in 1× Tris-buffered saline (TBS) and 0.1% Tween-20 (TBST)) for 1 h at room temperature, followed by an overnight incubation at 4 °C with primary antibodies. Blots were then washed three times with TBST and incubated with IRDye 680RD goat anti-mouse IgG secondary antibody (LI-COR Biosciences) and IRDye 800CW goat anti-rabbit IgG secondary antibody (LI-COR Biosciences) for 1 h in blocking buffer at room temperature. Blots were washed three times with TBST and imaged on a LI-COR Odyssey Dlx. Western blot analysis and quantification were performed using ImageStudio software.
RAF inhibitor titrations in mutant KRAS-expressing cell linesCells were plated on 12-well plates and allowed to adhere and grow overnight. Inhibitor incubations were started when cells were 80–90% confluent for 4-h incubations or at 50% confluence for 24-h incubations. All inhibitor titrations were performed in FBS-containing medium. Cells were treated with LXH-254, LF-268, AZ628 (initial concentration: 10 µM, threefold serial dilutions, final [DMSO] = 0.05%) or tovorafenib (initial concentration: 10 µM (HCT-116 and SW-480) or 50 µM (Mia PaCa-2, MDA-MB-453, MDA-MB-231 and DLD-1), threefold serial dilutions, final [DMSO] = 0.05%) for 4 or 24 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Next, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue were added to each sample, followed by vortexing and heating at 95 °C for 5 min. Eluted proteins were subjected to SDS–PAGE and western blot analysis using p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology), phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology) or phospho-MEK1/2 (S217/S221) (41G9) rabbit mAb (Cell Signaling Technology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences) antibodies at 4 °C.
Pulldowns using 268-TCOLysis buffer and washing buffer 1 consisted of 50 mM Tris pH 7.8, 120 mM NaCl, 10 mM NaF, 1 mM Na3VO4, 1 mM EDTA and 1% (v/v) IGEPAL CA-630. Washing buffer 2 consisted of 50 mM Tris pH 7.8, 120 mM NaCl and 1 mM EDTA. Denaturing buffer consisted of 50 mM Tris pH 8.5, 6 M guanidinium chloride, 5 mM TCEP (added fresh) and 10 mM CAM (added fresh). Pierce protease inhibitor tablets (A32963) and the Pierce 660-nm protein assay were obtained from Thermo Scientific. NHS-activated Sepharose 4 fast flow resin was obtained from GE Healthcare (17090601). LysC lysyl endopeptidase (MS-grade) was obtained from Wako. MS-grade trypsin was obtained from Pierce.
Probe treatment and cell lysisCells were grown on 10-cm plates in DMEM supplemented with 10% (by volume) FBS at 37 °C in a humidified incubator containing 5% CO2 until 90% confluence. The 268-TCO probe was added to the cells by replacing medium with fresh DMEM (5 ml) containing 10% FBS and 268-TCO (5 µM) or DMSO (0.1% in the final medium). Cells were incubated with 268-TCO for 30 min at 37 °C in the incubator and the medium was removed immediately after incubation. The cells were quickly washed with ice-cold Dulbecco’s PBS (DPBS) (5 ml, one time) and immediately lysed with ice-cold lysis buffer (500 µl). Cells were scraped into prechilled 1.5-ml Eppendorf tubes and were centrifuged at 17,000g for 20 min at 4 °C. The supernatant of lysates was collected and protein concentration was measured using the Pierce 660-nm protein assay. The protein concentration of lysates was diluted to 1.5 mg ml−1 with ice-cold lysis buffer.
Capture of probe-bound kinase complexes using Tz-BeadsTz-Beads were generated according to previously described protocol32. To reduce background contaminants, lysates were precleared by incubating with 15 µl (volume of drained beads) of Sepharose beads coupled to ethanolamine for 1 h at 4 °C before incubation with Tz-beads. For each pulldown experiment, 15 µl (volume of drained beads) of Tz-Beads were added to a 1.5-ml Eppendorf tube and were washed with ice-cold lysis buffer (three times; 400 µl for each wash). Next, 750 µg of protein lysates (1.5 mg ml−1) were added to Tz-Beads (15 µl) and was gently incubated on an end-to-end rotator for 30 mins at 4 °C. After incubation with Tz-Beads, the flowthrough was quickly removed by aspiration. The beads were then washed with ice-cold washing buffer 1 by gently inverting the tube four times (three times; 400 µl for each wash), followed by washing with washing buffer 2 by gently inverting the tube for four times (three times; 400 µl for each wash). The target protein should be enriched and bound to the Tz-Beads by the end of this step.
On-bead tryptic digestion of protein targets for MS/MS analysisTo detect enriched targets using LC–MS, the washed beads were resuspended in 50 µl of denaturing buffer and were boiled at 95 °C for 5 min. After cooling down, 100 mM TEAB (50 µl) was added. The pH value was adjusted to 8–9 by adding NaOH (1 M). LysC lysyl endopeptidase (1 µg) was then added and incubated with the beads at 37 °C for 2 h in a thermal mixer agitating at 1,400 rpm. After incubation, the suspension was diluted with 100 mM TEAB (100 µl) and MS-grade trypsin (1 µg) was added. The pH was adjusted to 8–9. The beads were incubated with trypsin overnight at 37 °C in a thermal mixer agitating at 1,400 rpm. After incubation, buffer A (200 µl) was added to the beads and trypsin was quenched by adjusting the pH to 2–3 using formic acid. The resulting supernatant was desalted on C18 StageTip and washed once with buffer A (50 µl). The tryptic peptides were eluted off the C18 StageTip using buffer B (50 µl). The eluted solution was dried in a SpeedVac and then reconstituted with buffer A (20 µl) for LC–MS analysis.
Data-dependent acquisition for proteomic experimentsPeptides were separated on a nanoAcquity ultrahigh-performance LC (UPLC) instrument with a 12-cm long fused silica capillary column (Polymicro Technologies, 1068150019; flexible fused silica capillary tubing, inner diameter: 75 µm, outer diameter: 375 µm) made in-house with a laser puller and packed with 5 µm of 120-Å reverse-phase C18 beads (ReproSil-Pur 120 C18-AQ, Dr. Maisch HPLC, r15.aq). The LC gradient was 90 min long with 10–35% B at 200 nl min−1. LC solvent A was 0.1% acetic acid and LC solvent B was 0.1% acetic acid and 99.9% acetonitrile. MS data were collected with a Thermo Scientific Orbitrap Fusion Tribrid MS instrument. Data-dependent analysis was applied using Top15 selection with collision-induced dissociation fragmentation. Raw data were analyzed using MaxQuant and search engine Andromeda using default settings: multiplicity set to 1, digestion set to trypsin/P, variable modifications set to oxidation (M) and acetylation (protein N terminus), label-free quantification (LFQ) minimal ratio count set to 2, LFQ minimal number of neighbors set to 3, LFQ average number of neighbors set to 6, MS/MS spectra searched against the UniProt human database (updated July 22, 2015), false discovery rate (FDR) set to 0.01 and first search and MS/MS search mass tolerance set to 10 ppm. The data in the ‘protein groups’ result table were processed with Perseus software. MaxQuant intensity values of identified proteins were used for all downstream analysis. We only considered proteins identified if MaxQuant was able to compute corresponding protein intensity values. Identified proteins that were classified as ‘only identified by site’, ‘reverse’ or ‘contaminant’ were filtered and removed from the table. Proteins with ≤1 peptide counts were filtered and removed. All intensity values were log2-transformed. Missing protein intensity values for identified proteins were imputed using Perseus by sampling from a distribution downshifted by 1.3 and having a width of 0.25. P values were calculated using a two-tailed, two-sample t-test. Enrichment scores (log2(intensity 268-TCO/intensity DMSO)) were calculated using the relative intensity values from probe-treated and DMSO-treated samples with confidence values (log10(P value)) for each identified protein. We defined significant targets as protein hits with an enrichment score ≥ 1.0 and a confidence value ≥ 1.4.
Kinobead enrichmentLysis buffer and washing buffer 1 consisted of 50 mM Tris pH 7.8, 120 mM NaCl, 10 mM NaF, 1 mM Na3VO4, 1 mM EDTA and 1% (v/v) IGEPAL CA-630. Washing buffer 2 consisted of 50 mM Tris pH 7.8, 120 mM NaCl and 1 mM EDTA. Denaturing buffer consisted of 50 mM Tris pH 8.5, 6 M guanidinium chloride, 5 mM TCEP (added fresh) and 10 mM CAM (added fresh). Pierce protease inhibitor tablets (A32963) and the Pierce 660-nm protein assay were obtained from Thermo Scientific. NHS-activated Sepharose 4 fast flow resin was obtained from GE Healthcare (17090601). LysC lysyl endopeptidase (MS-grade) was obtained from Wako. MS-grade trypsin was obtained from Pierce.
Generation of kinobeadsKinobeads were generated as previously described30. Then, 150 μl of cellular lysates (in modified RIPA buffer) were incubated with kinobeads for 3 h at 4 °C. Beads were then washed sequentially with twice with cold modified RIPA buffer and three times with cold 1× TBS. Proteins on beads were then denatured by resuspending in denaturing buffer (6 M guanidinium chloride, 50 mM Tris, 5 mM TCEP and 10 mM CAM) and heating at 95 °C for 5 min. The slurry was then diluted with 100 mM TEAB to a final concentration of 50 mM. After adjusting the pH to 8–9, LysC was added to the beads and incubated at 37 °C for 2 h. Samples were diluted twofold with 100 mM TEAB and incubated overnight with trypsin. The resulting peptides were subjected to a C18 cleanup, dried and resuspended in an 80:20 mixture of acetonitrile and water mixture and subsequently analyzed by LC–MS/MS.
Preparation of cell lysatesIn a 15-cm plate, cells were washed with ice-cold DPBS three times and lysed with 250 µl of ice-cold modified RIPA buffer (50 mM Tris, 150 mM NaCl, 10mM NaF, 1% IGEPAL CA-630, 0.25% sodium deoxycholate and 5% glycerol, pH 7.8, supplemented with protease inhibitor, 1 mM PMSF and phosphatase inhibitor cocktails 2 + 3). Cell lysates were centrifuged at 17,000g for 10 min at 4 °C. The supernatant was collected and quantified using Pierce 660-nm protein assay reagent and diluted to 2.0 mg ml−1 with ice-cold lysis buffer.
Inhibitor treatment and kinase enrichment with kinobeadsThe lysates (160 µl) were then incubated DMSO or 10 µM of inhibitor for 30 min on an end-to-end rotator at 4 °C. Meanwhile, 10 µl of a 50% kinobead slurry was washed with 500 µl of modified RIPA buffer twice. The inhibitor-treated lysates were then added to the drained kinobeads and incubated on an end-to-end rotator for 3 h at 4 °C. After incubation, the beads were spun down and the supernatant was aspirated off. The beads were then washed with 500 µl of ice-cold modified RIPA buffer twice and with 500 µl of ice-cold TBS buffer (50 mM Tris pH 7.8 and 150 mM NaCl) three times to remove the detergent.
On-bead trypsinization and LC–MS sample preparationThe washed beads were resuspended in 25 µl of denaturing buffer (6 M guanidinium chloride, 100 mM Tris pH 8.5, 5 mM TCEP (added fresh) and 10 mM CAM (added fresh)). The bead slurry was vortexed briefly and then boiled at 95 °C for 5 min (with pressure released frequently). The bead slurry was diluted with 25 µl of 100 mM TEAB in water. The pH of the resulting suspension was adjusted to 8–9 by adding 1 µl of 1 N NaOH at a time. Next, 0.4 µg of LysC was added to the slurry and agitated on a thermomixer at 37 °C for 2 h at 1,400 rpm. The slurry was then diluted with 50 µl of 100 mM TEAB. Then, 0.4 µg of sequencing-grade trypsin was added to the slurry and the sample was agitated overnight at 37 °C at 800 rpm on a thermomixer. After trypsinization, the slurry was diluted with 100 µl of buffer A (5% acetonitrile in water and 0.1% TFA) containing 1% formic acid. The resulting slurry was agitated at room temperature for 5 min. The resulting supernatant was then loaded onto a C18 column made in-house, washed with 50 µl of buffer A and eluted to a low-retention Eppendorf tube using 50 µl of buffer B (80% acetonitrile in water and 0.1% TFA). The peptides were then resuspended in 20 µl of buffer A to render the final samples.
Immobilized metal affinity chromatography enrichmentFe3+-NTA-loaded beads were washed with ten bead volumes of 80% aqueous acetonitrile with 0.1% TFA. Then, 20 µl of peptides (in 80% aqueous acetonitrile with 0.1% TFA) were incubated with the beads and phosphopeptides were enriched. Phosphopeptides were eluted twice with 50 mM KH2PO4/NH4OH (pH 10), combined, pH-neutralized and dried by vacuum centrifugation. The phosphopeptides were then subjected to a C18 cleanup, dried and resuspended in an 80:20 mixture of acetonitrile and water, followed by LC–MS/MS analysis.
Data-dependent acquisition and analysisPeptides were separated on a nanoAcquity UPLC instrument with a 12-cm-long fused silica capillary column (Polymicro Technologies, 1068150019; flexible fused silica capillary tubing, inner diameter: 75 µm, outer diameter: 375 µm) made in-house with a laser puller and packed with 5 µm of 120-Å reverse-phase C18 beads (ReproSil-Pur 120 C18-AQ, Dr. Maisch HPLC, r15.aq). The LC gradient was 90 min long with 10–35% solvent B at 200 nl min−1. LC solvent A was 0.1% acetic acid in water. LC solvent B was 0.1% acetic acid in acetonitrile. MS data were collected with a Thermo Scientific Orbitrap Fusion Tribrid MS instrument. The data analysis protocol was modified on the basis of a protocol previously described32,53. Raw datasets were analyzed using MaxQuant and search engine Andromeda using default settings: multiplicity set to 1, digestion set to trypsin/P, variable modifications set to oxidation (M) and acetylation (protein N terminus), LFQ minimal ratio count set to 2, LFQ minimal number of neighbors set to 3, LFQ average number of neighbors set to 6, MS/MS spectra searched against the UniProt human database (updated July 22, 2015), false discovery rate (FDR) set to 0.01 and first search and MS/MS search mass tolerance set to 10 ppm. The data in the ‘protein groups’ result table were processed with Perseus software. The missing protein intensity values in LFQ analyses were imputed by sampling from a distribution downshifted by 1.3 with a width of 0.2. The imputed LFQ intensity values of identified proteins were used for all downstream analyses. We only considered proteins as quantified if MaxQuant was able to compute corresponding protein intensity values in DMSO-treated samples. Identified proteins that were classified as ‘only identified by site’, ‘reverse’ or ‘contaminant’ were filtered and removed from the table. Proteins with one or fewer peptide counts were filtered and removed. All intensity values were log2-transformed. P values were calculated using two-tailed, two-sample t-tests. Competition scores (log2R) = (log2(intensity DMSO-treated/intensity inhibitor-treated)) were calculated using the relative intensity values from DMSO-treated and inhibitor-treated lysates with confidence values = log10(P value) for each identified protein. We defined significantly competed kinases as protein hits with a competition score ≥ 1.5 and a confidence value ≥ 1.5 from a two-sample t-test with an FDR of 0.05 (n = 3).
Data-independent acquisition (DIA) and analysis for kinobead competition with four RAF inhibitorsPeptide samples were separated on an EASY-nLC 1200 System (Thermo Fisher Scientific) using 20-cm-long fused silica capillary columns (inner diameter: 100 μm, laser pulled in-house with Sutter P-2000) packed with 3 μm of 120-Å reverse-phase C18 beads (Dr. Maisch). The LC gradient was 90 min long with 6–45% solvent B at 300 nl min−1. LC solvent A was 0.5% (v/v) aqueous acetic acid and LC solvent B was 80% acetonitrile in 0.5% (v/v) acetic acid. MS data were collected with a Thermo Fisher Scientific Orbitrap Fusion Lumos using a DIA method with a 120,000-resolution Orbitrap MS1 scan, 12-m/z isolation window and 30,000-resolution Orbitrap MS2 scans for precursors from 400 to 1,000 m/z. Raw files were converted to mzML using MSConvert (version 3.0.24285) and spectral libraries were built using MSFragger-DIA53 with FragPipe (version 22.0) and MSFragger (version 4.1), with quantification through DIA-NN54 version 1.8.2. The database search was against the UniProt human database (downloaded July 26, 2023) with supplemental spike-in of common contaminants, containing 42,440 sequences and 42,440 reverse-sequence decoys. For the MSFragger analysis, both precursor and initial fragment mass tolerances were set to 20 ppm. Spectrum deisotoping, mass calibration and parameter optimization were enabled. Enzyme specificity was set to ‘stricttrypsin’ and ‘lysc’ and up to two missed cleavages were allowed. Carbamidomethylation of cysteine (−57.02146 Da) was set as a fixed modification and the maximum number of variable modifications per peptide was set to 3. FragPipe/DIA-NN output files (pg_matrix.tsv and pr_matrix.tsv) were processed and analyzed. Missing values were imputed with the lowest value from the raw data to represent the limit of detection. Protein kinases were identified by matching UniProt identifiers to those annotated with ‘protein kinase activity’ in the UniProt database. To generate a unique list of kinases, duplicate gene names were filtered to select only the isoform with the highest raw intensity value in the DMSO condition. To ensure that only faithfully identified proteins were analyzed, we only considered proteins that were quantified in all three DMSO repetitions. For all other conditions, blank values were imputed as zeroes and any drug treatment conditions with all zero values were considered ‘fully competed’ off kinobeads. Ratios were calculated as (log2R) = (log2(intensity inhibitor-treated/intensity DMSO-treated)) and significant values exhibited a log2 fold change from DMSO < −2 (75% reduction) and P < 0.05.
Quantifying relative expression and phosphorylation status of MAPK pathway proteins in mutant KRAS-expressing cell linesMutant KRAS-expressing cell lines were plated onto six-well plates and allowed to adhere and grow overnight. The next morning, cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was transferred to Eppendorf tubes and cleared by centrifugation at 17,000g for 10 min at 4 °C; the supernatant was collected. Next, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue was added to each sample, followed by vortexing and heating at 95 °C for 5 min. Eluted proteins were subjected to SDS–PAGE and western blot analysis using A-RAF antibody (A-5) (Santa Cruz Biotechnology), B-RAF antibody (F-7) (Santa Cruz Biotechnology), C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology), GAPDH mouse mAb (A-3) (Santa Cruz Biotechnology), phospho-C-RAF (S338) (56A6) rabbit mAb (Cell Signaling Technology), phospho-C-RAF (S259) antibody (Cell Signaling Technology), phospho-C-RAF (S289/S296/S301) antibody (Cell Signaling Technology), phospho-B-RAF (S445) antibody (Cell Signaling Technology), phospho-C-RAF (S621) polyclonal antibody (Invitrogen), p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology), phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology), phospho-MEK1/2 (S217/S221) (41G9) rabbit mAb (Cell Signaling Technology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences).
Quantifying relative expression and phosphorylation status of MAPK pathway proteins in mutant KRAS-expressing cell lines treated with MEK inhibitorsMutant KRAS-expressing cell lines were plated onto six-well plates and allowed to adhere and grow overnight. The next morning, cells were treated with MEK inhibitors for 4 h at 37 °C. Mia PaCa-2, HCT-116, SW-480 or MDA-MB-453 cells were incubated with 240 nM cobimetinib, 36 nM CH5126766 or 12 nM GDC-0623 with the exception of Mia PaCa-2, HCT-116 and SW-480 cells that were harvested to detect the ERK and phosphor-ERK levels, which were treated with 40 nM cobimetinib, 6 nM CH5126766 or 2 nM GDC-0623. At the end of the treatment period, the cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was transferred to Eppendorf tubes and cleared by centrifugation at 17,000g for 10 min at 4 °C; the supernatant was collected. Next, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue was added to each sample, followed by vortexing and heating at 95 °C for 5 min. Eluted proteins were subjected to SDS–PAGE and western blot analysis using A-RAF antibody (A-5) (Santa Cruz Biotechnology), B-RAF antibody (F-7) (Santa Cruz Biotechnology), C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology), GAPDH mouse mAb (A-3) (Santa Cruz Biotechnology), phospho-C-RAF (S338) (56A6) rabbit mAb (Cell Signaling Technology), phospho-C-RAF (S259) antibody (Cell Signaling Technology), phospho-C-RAF (S289/S296/S301) antibody (Cell Signaling Technology), phospho-B-RAF (S445) Antibody (Cell Signaling Technology), anti-phospho-B-RAF T401 antibody produced in rabbit (Sigma-Aldrich), p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology), phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology), phospho-MEK1/2 (S217/S221) (41G9) rabbit mAb (Cell Signaling Technology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences).
CIAR-293 cell linesThe BCL-xL-based CIAR construct containing the hypervariable region (HVR) of KRAS4a was generated in pcDNA5/FRT/TO (Thermo Fisher). The construct was integrated into Flp-In T-Rex 293 cells. Transfection was performed using turbofectin (Origene) followed by hygromycin selection (Thermo Fisher) for 7–10 days. This CIAR construct consists of the guanine exchange factor, Son of Sevenless (SOS), flanked by both BCL-xL and the peptide BH3. SOS catalytic activity is inhibited by the interaction between BCL-xL and BH3. A115 disrupts this interaction, thereby alleviating autoinhibition of SOS, which results in increased RAS activation. An NS3a-based CIAR construct (NS3a-CIAR) containing the HVR of KRAS4a was stably integrated into HEK293 cells harboring a Bxb1 attP site via lentivirus. As with A115 in the BCL-xL-based CIAR construct, danoprevir disrupts an inhibitory interaction between NS3a and the peptide ANR, thereby increasing SOS activity and activating RAS. HA–BRAF-WT, HA–BRAF-G615R or HA–BRAF-G615H were subsequently integrated into these cells using Bxb1 recombinase.
Inhibitor titrations in CIAR-293 cellsCIAR-293 cells were plated on poly(d-lysine)-coated plates in DMEM + 10% FBS and allowed to grow and adhere overnight. Cells were then serum-starved for 18 h, followed by a 1-h incubation with 100 nM A-1155463 or DMSO (0.05%) (ChemieTek) at 37 °C. Cells were then exposed to LXH-254 (initial concentration: 10 µM, threefold serial dilutions) in the presence of 100 nM A-1155463 for 3 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was transferred to Eppendorf tubes and cleared by centrifugation at 17,000g for 10 min at 4 °C; the supernatant was collected. Next, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue was added to each sample, followed by vortexing and heating at 95 °C for 5 min. Eluted proteins were subjected to SDS–PAGE and western blot analysis using a combination of p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology) and phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology) or phospho-MEK1/2 (S217/S221) (41G9) rabbit mAb (Cell Signaling Technology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences) antibodies.
Coimmunoprecipitation of C-RAF with B-RAF in CIAR-293 cellsCIAR-293 cells were plated on six-well poly(d-lysine)-coated plates in DMEM + 10% FBS and allowed to grow and adhere overnight. Cells were then serum-starved for 18 h, followed by a 1-h incubation with 100 nM A-1155463 (ChemieTek) or DMSO (0.05%). Cells were then exposed to LXH-254 (initial concentration: 50 µM, fivefold serial dilutions) for 3 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was transferred to Eppendorf tubes and cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Meanwhile, protein G agarose beads (Cell Signaling Technology) were loaded with B-RAF antibody (F-7, Santa Cruz Biotechnology), with the following protocol. Beads were quickly washed by gentle centrifugation three times with modified RIPA buffer on ice and then resuspended in modified RIPA buffer. Antibody (5 µg of antibody per 20 µl of 50% bead slurry) was added and incubated with beads for 2.5 h at 4 °C with end-over-end rotation. Beads were quickly washed with modified RIPA buffer followed by the addition of 200 µl of cell lysate (1 mg ml−1 protein concentration) and incubation at 4 °C for 2 h with end-over-end rotation. Beads were quickly washed three times with modified RIPA buffer and proteins were eluted with 1× SDS loading dye containing 50 mM Tris pH 6.8, 2% SDS, 10% glycerol, 1% β-mercaptoethanol and 0.02% bromophenol blue. Eluted proteins were subjected to SDS–PAGE and western blot analysis using B-RAF antibody (F-7, Santa Cruz Biotechnology) and C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology).
Coimmunoprecipitation of C-RAF with B-RAF in mutant KRAS-expressing cells after LXH-254 treatmentMia PaCa-2, MDA-MB-231, SW-480 and MDA-MB-453 cells were plated on six-well plates in DMEM + 10% FBS at 75% confluence and allowed to adhere and grow overnight. HCT-116 cells were plated on six-well plates in McCoy’s 5A medium at 50% confluence and allowed to adhere and grow overnight. Cells were then exposed to LXH-254 (in Mia PaCa-2 cells, initial concentration: 50 or 10 µM, fivefold serial dilutions; in HCT-116, SW-480 and MDA-MB-453 cells, initial concentration: 10 µM, fivefold serial dilutions; in MDA-MB-231 cells, initial concentration: 2 µM, fivefold serial dilutions) for 4 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Meanwhile, protein G agarose beads (Cell Signaling Technology) were loaded with B-RAF antibody (F-7, Santa Cruz Biotechnology), with the following protocol. Beads were quickly washed by gentle centrifugation three times with modified RIPA buffer on ice and then resuspended in modified RIPA buffer. Antibody (5 µg of antibody per 20 µl of 50% bead slurry) was added and incubated with beads for 2.5 h at 4 °C with end-over-end rotation. An antibody control was also prepared for SW-480 lysate using a mouse IgG antibody (Thermo Scienific) in place of the B-RAF antibody. Beads were quickly washed once with modified RIPA buffer, followed by the addition of 200 µl of cell lysate. Samples were then incubated at 4 °C for 2 h with end-over-end rotation. A bead sample that was not loaded with any antibody was incubated with SW-480 cell lysate as a background control. Beads were quickly washed three times with modified RIPA buffer by centrifugation and proteins were eluted with 1× SDS loading dye containing 50 mM Tris pH 6.8, 2% SDS, 10% glycerol, 1% β-mercaptoethanol and 0.02% bromophenol blue. Eluted proteins were subjected to SDS–PAGE and western blot analysis using a combination of B-RAF antibody (F-7, Santa Cruz Biotechnology), C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology) or phospho-C-RAF (S259) antibody (Cell Signaling Technology).
SECMia PaCa-2 cells were plated on 15-cm plates and allowed to adhere and grow overnight. For live-cell treatments, cells were incubated with DMSO, LXH-254 (10 µM), cobimetinib (500 nM) or GDC-0623 (40 nM) at indicated concentrations for 4 h at 37 °C. Cells were then lysed with modified RIPA, transferred to Eppendorf tubes and cleared by centrifugation at 17,000g for 10 min at 4 °C; the supernatant was collected. Proteins in lysates were then separated using SEC with a Superdex 200 Increase 10/300 GL column on a fast protein LC instrument. The elution buffer contained 20 mM Tris pH 8.0, 150 mM NaCl and 10% glycerol. Buffer was pumped through the column at 0.5 ml min−1 for 60 min with fractions collected every min. Samples were then collected, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue was added, before heating at 95 °C for 5 min. Samples were then subjected to SDS–PAGE and western blotting using A-RAF antibody (A-5) (Santa Cruz Biotechnology), B-RAF antibody (F-7, Santa Cruz Biotechnology), C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology), 14-3-3 (pan) E9S9M rabbit mAb (Cell Signaling Technology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences).
Coimmunoprecipitation of A-RAF with C-RAF in Mia PaCa-2 cells treated with LXH-254Mia PaCa-2 cells were plated on six-well plates in DMEM + 10% FBS at 75% confluence and allowed to adhere and grow overnight. Cells were then exposed to LXH-254 (initial concentration: 50 µM, fivefold serial dilutions) for 4 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was transferred to Eppendorf tubes and cleared by centrifugation at 17,000g for 10 min at 4 °C; the supernatant was collected. Meanwhile, protein A agarose beads (Cell Signaling Technology) were loaded with C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology), with the following protocol. Beads were quickly washed by gentle centrifugation three times with modified RIPA buffer on ice and then resuspended in modified RIPA buffer. Antibody (10 µg antibody per 20 µl of 50% bead slurry) was added and incubated with beads for 2.5 h at 4 °C with end-over-end rotation. Beads were quickly washed, followed by the addition of 200 µl of cell lysate. Samples were then incubated at 4 °C for 2 h with end-over-end rotation. Beads were quickly washed three times with modified RIPA buffer by centrifugation and proteins were eluted with 1× SDS loading dye containing 50 mM Tris pH 6.8, 2% SDS, 10% glycerol, 1% β-mercaptoethanol and 0.02% bromophenol blue. Eluted proteins were subjected to SDS–PAGE and western blot analysis using A-RAF antibody (A-5) (Santa Cruz Biotechnology) and C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology).
Encorafenib titrations in mutant KRAS-expressing cell linesHCT-116 cells were plated at 50% confluence on 12-well plates in McCoy’s 5A medium + 10% FBS and allowed to grow and adhere overnight. Mia PaCa-2 cells were plated at 75% confluence on 12-well plates in DMEM + 10% FBS and allowed to grow and adhere overnight. Cells were then exposed to encorafenib (initial concentration: 20 µM, threefold serial dilutions) for 4 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Next, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue was added to each sample, followed by vortexing and heating at 95 °C for 5 min. Samples were then subjected to SDS–PAGE and western blot analysis using a combination of p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology) and phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology) or phospho-MEK1/2 (S217/S221) (41G9) rabbit mAb (Cell Signaling Technology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences).
In-cell western blot protocolHCT-116 cells were plated on 96-well plates in McCoy’s 5A medium + 10% FBS at 50% confluence and allowed to grow and adhere overnight. Cells were then exposed to LXH-254 (initial concentration: 10 µM, threefold serial dilutions) for 30, 60 and 240 min at 37 °C. The medium was aspirated and replaced with 4% PFA in PBS solution, before incubating at room temperature for 25 min. Samples were then incubated with 125 mM glycine in 1× PBS for 5 min, followed by blocking with Intercept PBS blocking buffer (LI-COR Biosciences) for 1 h at 37 °C. Then, p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology) and phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology) were diluted in Intercept PBS blocking buffer (LI-COR Biosciences) and added to the samples, followed by incubation for 1 h at room temperature. Samples were then washed three times with 1× PBS + 0.1% Tween-20, followed by the addition of IRDye 680RD goat anti-mouse IgG secondary antibody (LI-COR Biosciences) and IRDye 800CW goat anti-rabbit IgG secondary antibody (LI-COR Biosciences) and incubation for 1 h in blocking buffer at room temperature. Samples were then washed three times with 1× PBS + 0.1% Tween-20. Plates were then imaged on a LI-COR Odyssey Dlx.
Encorafenib and LXH-254 cotreatment protocolHCT-116 cells were plated at 50% confluence on 12-well plates in McCoy’s 5A medium + 10% FBS and allowed to grow and adhere overnight. Mia PaCa-2 cells and MDA-MB-453 cells were plated at 75% confluence on 12-well plates in DMEM + 10% FBS and allowed to grow and adhere overnight. Cells were then exposed to encorafenib (1 µM) for 1 h at 37 °C, followed by replacement with LXH-254 (initial concentration: 10 µM, threefold serial dilutions) and incubation for 3 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Next, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue was added to each sample, followed by vortexing and heating at 95 °C for 5 min. Samples were then subjected to SDS–PAGE and western blot analysis using a combination of p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology) and phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology).
Coimmunoprecipitation of B-RAF, C-RAF and C-RAF pS259 with MEK in Mia PaCa-2 cells treated with LXH-254Mia PaCa-2 cells were plated on six-well plates in DMEM + 10% FBS at 75% confluence and allowed to adhere and grow overnight. Cells were then exposed to LXH-254 (10 µM) for 4 h at 37 ˚C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Meanwhile, protein A agarose beads (Cell Signaling Technology) were loaded with anti-MEK1 antibody (Sigma-Aldrich), with the following protocol. Beads were quickly washed by gentle centrifugation three times with modified RIPA buffer on ice and then resuspended in modified RIPA buffer. Antibody (10 µg of antibody per 20 µl of 50% bead slurry) was added and incubated with beads for 2.5 h at 4 °C with end-over-end rotation. Beads were quickly washed, followed by the addition of 200 µl of cell lysate. Samples were then incubated at 4 °C for 2 h with end-over-end rotation. Beads were quickly washed three times with modified RIPA buffer by centrifugation and proteins were eluted with 1× SDS loading dye containing 50 mM Tris pH 6.8, 2% SDS, 10% glycerol, 1% β-mercaptoethanol and 0.02% bromophenol blue. Eluted proteins were subjected to SDS–PAGE and western blot analysis using B-RAF antibody (F-7) (Santa Cruz Biotechnology), C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology), phospho-C-RAF (S259) antibody (Cell Signaling Technology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences).
Coimmunoprecipitation of B-RAF with MEK in Mia PaCa-2 cells treated with DFG-out-stabilizing inhibitorsMia PaCa-2 cells were plated on six-well plates in DMEM + 10% FBS at 75% confluence and allowed to adhere and grow overnight. Cells were then exposed to LXH-254 (2.5 µM), LF-268 (5 µM), tovorafenib (20 µM) or AZ628 (2 µM) for 4 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Meanwhile, protein A agarose beads (Cell Signaling Technology) were loaded with anti-MEK1 antibody (Sigma-Aldrich), with the following protocol. Beads were quickly washed by gentle centrifugation three times with modified RIPA buffer on ice and then resuspended in modified RIPA buffer. Antibody (10 µg of antibody per 20 µl of 50% bead slurry) was added and incubated with beads for 2.5 h at 4 °C with end-over-end rotation. Beads were quickly washed, followed by the addition of 200 µl of cell lysate. Samples were then incubated at 4 °C for 2 h with end-over-end rotation. Beads were quickly washed three times with modified RIPA buffer by centrifugation and proteins were eluted with 1× SDS loading dye containing 50 mM Tris pH 6.8, 2% SDS, 10% glycerol, 1% β-mercaptoethanol and 0.02% bromophenol blue. Eluted proteins were subjected to SDS–PAGE and western blot analysis using B-RAF antibody (F-7) (Santa Cruz Biotechnology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences).
Immobilized vemurafenib generationFirst, 1 ml of NHS-ester Sepharose 4 fast flow beads were washed three times with 5 ml of a 1:1 mixture of DMF and ethanol on a vacuum manifold. Next, 2.5 mg of compound 24 (synthesis protocol in Supplementary Information) and 250 µl of DIPEA were dissolved in 500 µL of a 1:1 mixture of DMF and ethanol and added to the beads. The conjugation reaction was incubated at room temperature overnight with end-over-end rotation. The next morning, beads were washed three times with 5 ml of a 1:1 mixture of DMF and ethanol and resuspended in 500 µl of the DMF–ethanol mixture containing 1 M EDCI-HCl. Then, 100 µl of ethanolamine and 250 µl of DIPEA were added to the mixture and the reaction was allowed to proceed overnight with end-over-end rotation. Beads were then washed three times with 2 ml of a 1:1 mixture of DMF and ethanol, three times with 2 ml of 0.5 M NaCl in water and three times with 2 ml of 20% ethanol in water, before resuspending with 500 µl of 20% ethanol in water and storing at 4 °C until use.
Pulldowns with immobilized vemurafenibHCT-116 cells were plated on a 15-cm plate and allowed to grow to confluence and adhere overnight. Cells were lysed with modified RIPA buffer. Next, 200 µl of 1 mg ml−1 lysate was aliquoted into separate Eppendorf tubes. Samples were then incubated with indicated concentrations of LXH-254, vemurafenib or DMSO for 1 h at 4 °C with end-over-end rotation. Meanwhile, vemurafenib beads were washed three times with modified RIPA. Inhibitor-incubated lysate was then added to 20 µl of 50% vemurafenib bead slurry for 3 h at 4 °C with end-over-end rotation. Beads were then washed three times with ice-cold lysis buffer and eluted by incubating with 30 µl of 1× SDS loading dye at 95 °C for 5 min. Eluted proteins were subjected to SDS–PAGE and western blot analysis using B-RAF antibody (F-7) (Santa Cruz Biotechnology), phospho-B-RAF (S445) antibody (Cell Signaling Technology) C-RAF (D4B3J) rabbit mAb (Cell Signaling Technology), phospho-C-RAF (S259) antibody (Cell Signaling Technology) and phospho-C-RAF (S338) (56A6) rabbit mAb (Cell Signaling Technology).
Measuring pERK levels in danoprevir-activated CIAR-293 cells stably expressing HA–B-RAF WT, HA–B-RAF-G615R or HA–B-RAF-G615HCIAR-293 cells stably expressing HA–B-RAF WT, HA–B-RAF-G615R or HA–B-RAF-G615H were grown in doxycycline (Dox; 2 μg ml−1)-containing DMEM supplemented with 10% FBS. The cells were treated with a gradient of danoprevir (initial concentration: 10 μM, threefold serial dilutions) or DMSO for 1 h at 37 °C. At the end of the treatment period, cells were lysed with a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Lysate was cleared by centrifugation at 17,000g for 10 min at 4 ˚C and the supernatant was collected. Cleared lysate was separated by SDS–PAGE, followed by western blot analysis to quantify ERK and pERK levels in lysate samples using a combination of p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology) and phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology).
RAF inhibitor titrations in danoprevir-activated CIAR-293 cells stably expressing HA–B-RAF WT, HA–B-RAF-G615R or HA–B-RAF-G615HNS3a-CIAR-293 cells expressing B-RAF WT, B-RAF-G615R or B-RAF-G615H mutant were grown in Dox (2 μg ml−1)-containing DMEM supplemented with 10% FBS. The cells were activated by incubating the cells with danoprevir for 1 h at 37 °C (40 nM and 10 nM for cells expressing B-RAF WT and G615 mutant, respectively). The activated cells were then treated with a gradient of LXH-254 (initial concentration: 20 μM, threefold serial dilutions), AZ628 (initial concentration: 2 μM, threefold serial dilutions) or LF-268 (initial concentration: 10 μM, threefold serial dilutions) for 3 h at 37 °C. At the end of the treatment period, cells were lysed with a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Cleared lysate was separated by SDS–PAGE followed by western blot analysis to quantify ERK and pERK levels in lysate samples using a combination of p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology) and phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology). The quantification data were then used to calculate IC50 values for each inhibitor.
Coimmunoprecipitation of Myc–MEK1 with HA-tagged B-RAF (WT and G615R mutant)NS3a-CIAR-293 cells expressing HA–B-RAF WT or HA–B-RAF-G615R mutant were grown in a 15-cm plate using Dox (2 μg ml−1)-containing DMEM supplemented with 10% FBS up to 80% confluence. The cells were then transfected with a plasmid containing an MEK1–TurboID fusion construct using PEI as the transfection reagent. After 24 h, the cells were transferred into poly(d-lysine)-coated six-well plates at 50% confluence and allowed to grow and adhere overnight. A well of nontransfected cells was used as a transfection control. Cells in each well were then lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Separately, anti-HA beads (Thermo Scientific Pierce anti-HA magnetic beads) were washed twice with the modified RIPA buffer and the cleared lysate was added to the washed beads, followed by incubation for 1 h at 4 °C with end-over-end rotation. A background control was also included by adding modified RIPA buffer to anti-HA beads instead of lysate. At the end of the incubation period, beads were quickly washed two times with modified RIPA buffer and two times with TBS buffer. Next, 3× SDS loading dye containing 150 mM Tris pH 6.8, 6% SDS, 30% glycerol, 3% β-mercaptoethanol and 0.06% bromophenol blue was added to each sample, followed by vortexing and heating at 95 °C for 8 min. Eluted proteins were subjected to SDS–PAGE separation and western blot analysis using a combination of anti-MEK1 antibody (Sigma-Aldrich), B-RAF antibody (F-7) (Santa Cruz Biotechnology) and GAPDH (14C10) rabbit monoclonal antibody (Cell Signaling Technology).
MEK inhibitor titrations in mutant KRAS-expressing cell linesMia PaCa-2, SW-480 or MDA-MB-453 cells were plated at 75% confluence on 12-well plates in DMEM + 10% FBS and HCT-116 cells were plated on 12-well plates in McCoy’s 5A medium at 50% confluence. Cells were allowed to grow and adhere overnight. Cells were then exposed to cobimetinib (initial concentration: 1.1 µM, threefold serial dilutions), trametinib, binimetinib or CH5126766 (initial concentrations: 370 nM, threefold serial dilutions), GDC-0623 (initial concentration: 123 nM, threefold serial dilutions) or compound 11, 12, 13, 14 or 15 (initial concentration: 10 µM, threefold serial dilutions) for 4 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Next, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue was added to each sample, followed by vortexing and heating at 95 °C for 5 min. Samples were then subjected to SDS–PAGE and western blot analysis using a combination of p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology) and phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology) or phospho-MEK1/2 (S217/S221) (41G9) rabbit mAb (Cell Signaling Technology) and purified mouse anti-MEK1 clone 25/MEK1 (BD Biosciences).
RAF inhibitor and MEK inhibitor cotreatments in mutant KRAS-expressing cell linesMia PaCa-2, SW-480 and MDA-MB-453 cells were plated at 75% confluence on 12-well plates in DMEM + 10% FBS and HCT-116 cells were plated on 12-well plates in McCoy’s 5A medium at 50% confluence. Cells were allowed to adhere and grow overnight. Cells were then pretreated with 40 nM cobimetinib, 2 nM trametinib, 16 nM binimetinib, 6 nM CH5126766, 2 nM GDC-0623, 80 nM 11, 360 nM 12, 120 nM 13, 600 nM 14 or 10 nM 15 for 1 h at 37 °C, followed by the addition of LXH-254 (initial concentration: 10 µM, threefold serial dilutions), LF-268 (initial concentration: 10 µM, threefold serial dilutions), AZ628 (initial concentration: 20 µM, threefold serial dilutions) or tovorafenib (initial concentration: 50 µM, threefold serial dilutions) and incubation for 3 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at 4 °C and the supernatant was collected. Next, 4× SDS loading dye containing 200 mM Tris pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol and 0.08% bromophenol blue was added to each sample, followed by vortexing and heating at 95 °C for 5 min. Samples were then subjected to SDS–PAGE and western blot analysis using a combination of p44/42 MAPK (ERK1/2) (3A7) mouse mAb (Cell Signaling Technology) and phospho-p44/42 MAPK (ERK1/2) D13.14.4E XP rabbit mAb (Cell Signaling Technology).
Bliss synergy analysisBliss synergy analysis was performed on cobimetinib–LXH-254 combination treatment pERK titration data using SynergyFinder 3.0, a free web-based application used to analyze multidose drug combinations55.
Coimmunoprecipitation of C-RAF with B-RAF in Mia PaCa-2 cells after MEK inhibitor and LXH-254 cotreatmentsMia PaCa-2 cells were plated on six-well plates in DMEM + 10% FBS at 75% confluence and allowed to adhere and grow overnight. Cells were then treated with MEK inhibitors (40 nM cobimetinib, 2 nM trametinib, 16 nM binimetinib, 6 nM CH5126766 or 2 nM GDC-0623) for 1 h at 37 °C, followed by the addition of LXH-254 (initial concentration: 50 µM, fivefold serial dilutions; for cobimetinib-treated samples, initial concentration: 10 µM, fivefold serial dilutions) and incubation for 3 h at 37 °C. Cells were lysed using a modified RIPA buffer containing 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10% glycerol, 1% IGEPAL, phosphatase inhibitor cocktails 2 + 3 (Sigma-Aldrich) and protease inhibitor tablet (Thermo Scientific). Cells were incubated in the buffer for 30 min at 4 °C with agitation. The lysate was cleared by centrifugation at 17,000g for 10 min at
Comments (0)