Animals

C57BL/6 J wild‑type (WT) mice were purchased from Vital River Laboratory (Beijing, China). Cardiomyocyte‑specific p38α‑knockout mice (Myh6-Cre, p38α flox/flox; designated as p38α‑CKO) were kindly provided by Huazhong Agricultural University. Briefly, the floxed Mapk14 (p38α) allele was engineered by strategically inserting a loxP site in the intron located upstream of Exon 2 and an additional loxP site within the intron downstream of Exon 3. The expression of Cre recombinase was specifically targeted to cardiomyocytes under the regulation of the endogenous Myh6 promoter. This Cre-mediated homologous recombination results in the deletion of the loxP-flanked Exon 2 to Exon 3 region of Mapk14 exclusively in cardiomyocytes, thereby abrogating the expression of functional p38α. The mice were maintained in an environment with regulated temperature (22–25℃) and humidity (40%-60%), following a 12-h light/dark cycle. They were provided with ad libitum access to food and water. For all experiments, male mice aged 8 to 10 weeks and weighing between 24 and 27 g were utilized.

Myocardial I/R injury model

Pentobarbital sodium was administered to mice by intraperitoneal injection for general anesthesia. After tracheal intubation and mechanical ventilation, a thoracotomy was conducted, and the left anterior descending coronary artery (LAD) was ligated with a 7‑0 silk suture. Ischemia was maintained for 45 min, followed by 24 h of reperfusion. Sham-operated mice underwent identical surgery with sutures inserted into myocardium without LAD ligation.

Animal grouping and VX-745 administration

Mice were randomly allocated into four experimental cohorts, each comprising six subjects (n = 6 per group): the sham-operated group (Sham), the sham-operated group treated with VX-745 (HY-10328, MedChemExpress) (Sham + VX-745), the myocardial I/R injury group (I/R), and the I/R group treated with VX-745 (I/R + VX-745). In accordance with the formulation protocol provided by MedChemExpress (MCE), VX-745 powder was freshly dissolved in a vehicle composed of 50% polyethylene glycol 300 (PEG300) and 50% sterile normal saline to prepare the working drug solution. According to established protocols [11, 30], VX-745 was administered intragastrically at a dose of 5 mg/kg body weight, 2 h prior to the commencement of myocardial ischemia surgery. To control for potential confounding effects of the solvent, animals in the Sham and I/R vehicle control groups received an equivalent volume of the blank 50% PEG300-saline vehicle via oral gavage at the corresponding time point.

Cell lines, plasmids and lentiviruses

HL-1 cells were purchased from Stem Recell (Shanghai, China; catalog no. STM-CL-6052). Plasmids overexpressing the target genes and the negative control vector (NC-oe) were constructed using the pT3-EF1a backbone to overexpress the mouse p38α (ID 1432), c-Myc (ID 4609), NCOA4 (ID 8031), c-Myc R291A, c-Myc R300A, c-Myc K304A, c-Myc K51R, c-Myc K149R and c-Myc K326R genes. Plasmids expressing short hairpin RNAs (shRNAs) targeting the genes of interest and the negative control vector (NC-sh) were constructed using the pLenti‑U6‑shRNA-CMV-GPF-2A-Puro backbone to knockdown the mouse p38α, c-Myc, NCOA4, and STUB1 (ID 10273) genes. The c-Myc knockout lentiviral was constructed using the pLV‑u6‑sgRNA1‑H1‑sgRNA2-EF1a-spCas9-P2A-Puro backbone. These plasmids or lentiviral vectors were packaged into HL-1 cells and neonatal mouse cardiomyocytes (NMCMs). When cells reached 70–80% confluency, two separate transfection/transduction procedures were performed. For plasmid transfection, plasmids were mixed with Opti-MEM (Beyotime, cat. no. C2753) and Lipo8000 transfection reagent (Beyotime, cat. no. C0533) before being added to cells. To perform lentiviral transduction, target cells were cultured with lentivirus and polybrene (MCE, cat. no. HY-112735) for the indicated incubation period.

Hypoxia-reoxygenation protocol in vitro

To mimic myocardial I/R injury in vitro, cardiomyocytes were subjected to OGD/R as previously described [50]. Briefly, cells at 70–80% confluence were incubated in pre-warmed serum-and glucose-free DMEM (Gibco, Cat# 11,966–025) in a hypoxic chamber flushed with 100% N₂ at 37 °C for 4 h. For reoxygenation, the medium was replaced with complete DMEM (Gibco, Cat# 11,965–092) supplemented with 10% FBS (Gibco, Cat# 10,099–141) and 1% penicillin–streptomycin (Gibco, Cat# 15,140–122), and cells were incubated at 37 °C under 17% O₂ and 5% CO2 for 4 h. Normoxic control cells were maintained in complete DMEM with 10% FBS at 37 °C, 5% CO2 for 24 h prior to analysis.

Isolation of neonatal mouse cardiomyocytes

Hearts were harvested, minced in ice-cold Ca2⁺/Mg2⁺-free Hank’s Balanced Salt Solution (HBSS, Gibco, Cat# 14,170,112), and digested with 0.125% trypsin (Gibco, Cat# 25,200,072) at 37 °C for 10 min. The supernatant from the first digestion was discarded, and the remaining tissue was sequentially digested with 1 mg/mL collagenase type II (Solarbio, Cat# C8150) at 37 °C. Released cardiomyocytes were collected in complete Dulbecco’s Modified Eagle Medium (DMEM, Gibco, Cat# 11,965,092) supplemented with 10% fetal bovine serum (FBS, Gibco, Cat# 10,099,141). This digestion-collection cycle was repeated 3–4 times until complete tissue dissociation. The pooled cell suspension was centrifuged at 500 × g for 5 min, resuspended in fresh complete DMEM, and plated in uncoated 35-mm dishes for 1.5 h at 37 °C, 5% CO2 to allow differential adhesion of non-myocytes. Suspended cardiomyocytes were harvested from the supernatant, seeded on laminin-coated (Sigma-Aldrich, Cat# L2020) culture dishes, and cultured in complete DMEM at 37 °C, 5% CO2 for 48 h prior to downstream experiments.

Adult mouse cardiomyocytes isolation and treatment

8 weeks old male mice were employed for the isolation of primary cardiomyocytes. The isolation protocol was adapted from previously published study, utilizing the Langendorff-free perfusion method [16]. In brief, the mice were anesthetized with sodium pentobarbital and secured on a dissection plate. The inferior vena cava and abdominal aorta were incised to facilitate blood drainage, followed by thoracotomy to fully expose the heart. Pre-warmed ethylenediaminetetraacetic acid (EDTA) buffer was gradually injected into the right ventricular apex at a controlled flow rate, and the ascending aorta was clamped using forceps. The clamped heart was then transferred to a culture dish, where EDTA buffer was continuously perfused into the left ventricle. Subsequently, the heart was transferred to a perfusion buffer and then to a preheated collagenase buffer, maintaining a consistent perfusion rate of 4–5 mL/min until the myocardium appeared pale and softened. Following digestion, the aortic clamp was removed, and the ventricles were sectioned into 1 mm3 pieces and gently pipetted. Digestion was halted by the addition of a stop buffer, and the resulting cell suspension was filtered through a 100 μm strainer. Rod-shaped viable cardiomyocytes were enriched through multiple rounds of natural gravity sedimentation, each lasting 20 min, conducted at room temperature. The purified cardiomyocytes were then subjected to a sequential reintroduction of calcium using gradient calcium buffers to prevent calcium overload. Subsequently, the cells were resuspended in a laminin-coated plating medium and cultured at 37 °C in an atmosphere containing 5% CO2. Adenoviral vectors for the knockdown of mouse p38α (Adshp38α), c-Myc (Adshc-Myc), and STUB1 (AdshSTUB1) were developed utilizing the pDC316-U6-shRNA-CMV-EGFP backbone. Concurrently, plasmids for the overexpression of mouse c-Myc (Adc-Myc) and NCOA4 (AdNCOA4) were constructed using the pDC316-CMV-MCS-P2A-EGFP backbone. These constructs were employed to infect adult mouse primary cardiomyocytes at a multiplicity of infection (MOI) of 50 virus particles per cell, facilitating both gene knockdown and overexpression experiments.

RNA-seq profiling and analysis

Cardiomyocytes were transfected with shp38α or shControl plasmids. After transfection, samples were prepared and sent to Servicebio (Wuhan, China) for total RNA isolation, mRNA purification, library construction, and high-throughput sequencing. Differential gene expression analysis was performed using DESeq2 software to compare the two groups (shp38α vs. shControl), with the threshold set as q < 0.05 and |log₂FC|≥ 1. All differentially expressed genes (DEGs) were subjected to KEGG pathway enrichment analysis, which was conducted against the genome background and defined by the hypergeometric test (p < 0.05). A subset of DEGs was selected to generate a hierarchical clustering heatmap for the visualization of gene expression patterns.

Cell viability and LDH assay

Cell viability was determined using the Cell Counting Kit-8 (CCK-8; Beyotime, C0048) according to the manufacturer’s instructions. Briefly, cells were seeded in 96-well plates and incubated with the CCK-8 reagent at 37 °C for 2 h. Optical density (OD) values were measured at 450 nm using a microplate reader. Cytotoxicity was assessed with a Cytotoxicity Assay Kit (Beyotime, C0017), which quantifies cell membrane damage by measuring the activity of lactate dehydrogenase (LDH) released into the culture supernatant, following the manufacturer’s recommended protocol.

Western-blotting

Cultured cells or heart tissues were washed with ice-cold phosphate-buffered saline (PBS) and then homogenized in Radio Immunoprecipitation Assay (RIPA) Lysis Buffer (Beyotime) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1% (v/v) protease and phosphatase inhibitor cocktail (Roche, USA). Tissue lysates were prepared from infarcted regions. Protein concentrations were quantified using the Bicinchoninic Acid (BCA) Protein Assay Kit (Beyotime). Equal amounts of protein lysates were separated by 10 or 15% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Merck, Darmstadt, Germany). The membranes were blocked with 5% non-fat milk in Tris-buffered saline containing 0.1% Tween 20 (TBST) for 1 h at room temperature and then incubated overnight at 4 °C with primary antibodies. After washing with TBST (Servicebio, G0004), the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Protech, #SA00001-1/2, 1:3000) for 1.5 h at room temperature. Finally, blots were visualized using enhanced chemiluminescence (ECL) reagents (Invitrogen, USA). Band intensities were quantified by ImageJ software, and values were normalized to the corresponding loading controls. The primary antibodies used were as follows: anti-p-p38α (Proteintech, 28,796), anti-GPX4 (Proteintech, 30,388), anti-p38α (Proteintech, 14,064), anti-β-Tubulin (Proteintech, 10,094), anti-SLC40A1 (Proteintech, 26,601), anti-ACSL3 (Proteintech, 20,710), anti-HMOX1 (Proteintech, 10,701), anti-c-Myc (MCE, HY-P80626), anti-p–c-Myc (Ser62) (MCE, HY-P80511), anti-STUB1 (Proteintech, 55,430), anti-Ubiquitin (Proteintech, 10,201), and anti-NCOA4 (HUABIO, ER62707).

Real-time PCR assay

Total RNA is isolated from cardiomyocytes or tissues based on trizol (Beyotime, R0016) and then converted into cDNA using a reverse transcription kit (Vazyme, R201–01). Real- time quantitative polymerase chain reaction (qRT-PCR) was performed by SYBR Green assay (Vazyme, Q713). The expression levels of the target genes were normalized to the TUBB3 gene and are presented as 2-ΔΔCt values. The forward and reverse PCR primers for TUBB3 (mouse) were 5′- CATCAGCGATGAGCACGGCATA -3′ and 5′- GGTTCCAAGTCCACCAGAATGG -3′, the primers for MYC (mouse) were 5’- TCGCTGCTGTCCTCCGAGTCC-3′ and 5′-GGTTTGCCTCTTCTCCACAGAC-3′, the primers for STUB1 (mouse) were 5’- GCTGGAACAGTATCGAGGAACG-3′ and 5′- TTCCGCTGACACTCCTCCAGTT -3′, the primers for NCOA4 (mouse) were 5′- TGCCATTGGTCTTCAGGCTCCT -3′ and 5′- CAGGCATCGCTGAAGAAACTGC-3′, the primers for TFRC (mouse) were 5’- GAAGTCCAGTGTGGGAACAGGT -3′ and 5′-CAACCACTCAGTGGCACCAACA-3′, the primers for ACSL4 (mouse) were 5’- CCTTTGGCTCATGTGCTGGAAC -3′ and 5′- GCCATAAGTGTGGGTTTCAGTAC -3′.

Infarct size measurements

Surgical procedures for I/R were performed according to established protocols [24]. At 24 h post-surgery, mice were euthanized, and the heart was rapidly excised. The coronary artery was re-occluded at the site of the initial occlusion, and 2 mL of 1% Evans blue (Beyotime, Y025609) was continuously perfused into the inferior vena cava for 3 min. The heart was then removed and washed twice, followed by freezing at − 80 °C for 10 min and cutting into 1 mm-thick sections. Sections were incubated with 1% 2,3,5-triphenyltetrazolium chloride (TTC; Beyotime, C0651) at 37 °C for 30 min and subsequently fixed with 4% paraformaldehyde (PFA; Beyotime, P0099) for 2 h at room temperature. Finally, the hearts were photographed under a microscope, and the infarct area was quantified using ImageJ software (version 1.38 × ; National Institutes of Health, Bethesda, MD, USA). The remote area was stained blue, the area at risk was stained red, and the infarcted area was stained white. The left ventricular area was also measured using ImageJ software.

Echocardiography

Transthoracic echocardiography was performed using a Vevo 2100 system (Visual Sonics, Toronto, ON, Canada) equipped with an MS-400 imaging transducer. Mice were lightly anesthetized with isoflurane, and the chest hair was removed to expose the heart. Mice were placed in a supine position on an echogenic pad to minimize procedural bias and maintained under anesthesia during image acquisition. Echocardiographic measurements were obtained at 24 h after reperfusion in the myocardial I/R group. Left ventricular end-diastolic volume (LVEDV) and left ventricular end-systolic volume (LVESV) were determined by direct M-mode tracing of the left ventricular endocardial border in the parasternal long-axis view. Left ventricular ejection fraction (LVEF) and left ventricular fractional shortening (LVFS) were also calculated. LVEF was defined as the ratio of systolic to diastolic cardiac output. LVFS was calculated as the ratio of the difference between left ventricular end-diastolic diameter (LVEDD) and left ventricular end-systolic diameter (LVESD) to LVEDD. All echocardiographic data were acquired and analyzed by a technician blinded to the experimental groups.

Immunohistochemistry (IHC) assay

The samples were analyzed by immunohistochemistry using anti-p38α (proteintech, 14,064) and anti-4-HNE (MCE, HY-P81208) antibody. Two independent researchers evaluated the immunostaining results. According to the established procedure, all tissues were fixed in a 4% paraformaldehyde solution and then embedded in paraffin wax. Paraffin was then sliced into 4-μm thick slices, incubated overnight with the specified primary antibody, and then incubated with the secondary antibody.

Immunofluorescence

Initially, cells were placed on glass coverslips and treated with a 4% paraformaldehyde solution for 30 min to fix them. After fixation, the cells were treated with PBS solution containing 0.3% Triton X-100 (Beyotime, ST1723) for 20 min and then incubated with 5% bovine serum albumin (Beyotime, ST2249) solution for 1 h. Subsequently, cells were incubated at 4 °C overnight with primary antibody. After PBS washing, cells were further probed with fluorescent secondary antibodies (Abcam, ab150077). The nuclei were stained with DAPI (Beyotime, C1005). Images were captured using a confocal laser scanning microscope (Nikon A1 plus) equipped with a 60 × oil immersion objective lens. The signals were excited using 488 nm and 594 nm lasers, respectively, with emission collected through 500–550 nm and 570–620 nm filters. Images were captured at a resolution of 1024 × 1024 pixels and no additional contrast enhancement or gamma correction was applied. The following primary antibodies were used in this assay: anti-p-p38α (proteintech, 28,796), anti- GPX4 (proteintech, 30,388), anti-cTnT (proteintech, 68,300), anti-c-Myc (proteintech, 16,286), anti-c-Myc (proteintech, 67,447), anti-STUB1 (proteintech, 55,430), anti-NCOA4 (proteintech, 10,968).

Terminal deoxynucleotidyl transferase-mediated 2’-deoxyuridine 5’-triphosphate nick end labeling assay of myocardial tissue

Terminal deoxynucleotidyl transferase-mediated 2’-deoxyuridine 5’ triphosphate nick end labeling (TUNEL) assays were performed using the One-step TUNEL In Situ Apoptosis Kit (Elabscience, #E-CK-A422) in accordance with the manufacturer’s instructions. Cardiomyocytes were stained fluorescein isothiocyanate-labeled wheat germ agglutinin lectin. The sections were subsequently photographed using a confocal laser scanning microscope (Nikon A1 plus). Statistical analysis was performed using Image J and GraphPad Prism9.

Transmission electron microscopy

At 24 h after reperfusion, myocardial tissue was fixed with glutaraldehyde overnight. Then it was fixed with 1% osmic acid at 4 °C for 2–3 h, dehydrated with gradient alcohol (50%, 70%, 80%, 85%, 90%, 95%, 100%), soaked overnight with acetone and epoxy resin, and finally embedded and cured with epoxy resin. The tissue was cut into100 nm-thick sections and stained with lead and uranium. The mitochondrial morphology of cardiomyocytes was observed using a frozen trans mission electron microscopy (Thermo Fisher, Glacios). The damaged and undamaged mitochondria were counted in a field of view with a magnification of 1700 times within non-repeating unit areas in the infarct area and quantified using Image J.

Biochemical and ELISA assays

Whole blood (approximately 300 μL) was collected from each animal and incubated at room temperature for 1 h. Afterwards, the samples were centrifuged at 3000 rpm for 10 min at 4 °C to separate serum. The concentrations of creatine kinase and creatine kinase isoenzyme, aspartate aminotransferase, α-hydroxybutyrate dehydrogenase, alanine aminotransferase, urea nitrogen, and creatinine in serum were determined according the manufacturer’s instructions (Nanjing JianCheng). HL-1 cells were cultured in 6-well plates with a density of 2 × 105 cells per well. Cells were harvested and lysed after the corresponding process. The supernatant was collected by centrifugation to detect the level of Glutathione (Beyotime, S0053), Malondialdehyde (Beyotime, S0131), Dehydrogenase (Beyotime, C0019) and 12-HETE (Abcam, ab133034) according to the manufacturer’s instructions.

Iron, ROS, and lipid ROS levels

Iron, ROS, and lipid ROS levels were detected using Fe2Orange (MCE, HY-D1913), ROS Assay Kit (Beyotime, S0033), and BODIPY 581/591 C11 (MCE, HY-D1301). The cells were cultured in 6-well plates and left to rest overnight. After replacing the medium with fluorescent dye, the cells were incubated for 30 min. To remove excess fluorescent dye, rinse twice with PBS and then suspend in 300 μL PBS. Then, the fluorescence intensity of each sample was measured using the Beckman Coulter CytoFLEX, and CytExpert 2.4 software was used to interpret the results.

Co-immunoprecipitation assay

For co-immunoprecipitation assay, cells or heart tissue lysates were mixed with ice-cold immune-precipitation buffer (Beyotime, #P0013J) containing protease and phosphorylase inhibitor cocktail (Roche, USA). The mixture was then incubated with the target antibody at 4 °C overnight under constant agitation. Protein A/G agarose beads (Beyotime, #P2012) were incubated with the lysates for 3 h at 4 °C followed by washing, and then lysed with 1 × sodium dodecyl sulfate polyacrylamide gel electrophoresis sample buffer. The supernatant was subsequently used for western-blotting with corresponding antibodies: anti-c-Myc (MCE, YA497), anti-p62-c-Myc (MCE, YA211), anti-p-p38α (proteintech, 28,796), anti-STUB1 (proteintech, 55,430), anti-ubiquitin (proteintech, 10,201).

c-Myc ubiquitination detection

For cellular ubiquitination assays, cells were treated with 10 μM proteasome inhibitor MG132 (MCE, HY-13259) and incubated for an additional 12 h before harvest. Collected cells were lysed in pre-chilled immunoprecipitation (IP) buffer (Beyotime, #P0013J) supplemented with protease inhibitor cocktail, phosphatase inhibitor cocktail, and 10 mM N-ethylmaleimide (NEM, MCE, HY-D0843). For cardiac tissue samples harvested post-reperfusion, heart tissues were homogenized using the identical IP buffer containing protease and phosphatase inhibitor cocktails and 10 mM NEM. All cell and tissue lysates were incubated with the primary antibody against the target protein overnight at 4 °C under constant rotation. Protein A/G agarose beads (Beyotime, #P2012) were then added to the mixture and incubated for 3 h at 4 °C. The beads underwent five washes with an IP buffer. After complete removal of the washing solution, 1 × SDS-PAGE loading buffer was supplemented to the beads, and the samples were heated to dissociate bound proteins for subsequent western blotting with anti-ubiquitin antibody (Proteintech, 10,201).

Cleavage under targets and release using nuclease (CUT&RUN)

HL-1 and NMCMs cells were seeded into 12-well plates and transfected with overexpression plasmids c-Myc and knockdown plasmids c-Myc using Lipo8000™ (Beyotime, #C0533) according to the manufacturer’s instructions. Similarly, AMCMs cells were seeded into 12-well plates and transduced with c-Myc overexpression and knockdown adenoviruses, following the manufacturer’s guidelines. The following day, cells were treated with OGD/R or not. After that, cells were collected for CUT&RUN experiments using Hyperactive pG-MNase CUT and RUN Assay Kit (Vazyme, #HD101-01). Briefly, 1 × 105 fresh cells were collected and washed once in 100 µL of washing buffer, followed by bound to Concanavalin A (ConA) magnetic beads for 10 min at room temperature (RT). Cells were then treated with anti-c-Myc (MCE, HY-P80626) at 4 °C overnight. The following day, cells were washed twice with digitonin (DIG) washing buffer and incubated with pG-MNase enzyme at 4 °C for 1 h. After twice DIG washing, cells were incubated with CaCl2 at 4 °C for 1 h, followed by incubated with a stop buffer at 37 °C for 30 min. Then, beads were gathered, and DNA was eluted from the beads. Finally, qPCR tests were conducted following the manufacturer’s recommendations.

Statistical analysis

Data are expressed as mean ± SD from at least three independent biological replicates rather than technical duplicates. For in vivo experiments, n refers to the number of individual animals per group; for in vitro experiments, n refers to independent experiments performed on separate cell preparations or passages. Samples were randomly assigned to experimental groups, and investigators were blinded to group allocation during data acquisition and analysis. Prior to parametric statistical analyses, the normality of data distribution was assessed using the Shapiro–Wilk test. Comparisons between two groups were performed using a two-tailed unpaired Student’s t-test. One-way ANOVA followed by Tukey’s post-hoc test was used for multi-group comparisons, while two-way ANOVA with Bonferroni’s post-hoc test was applied for analyses containing two independent variables. Spearman’s rank correlation analysis was applied to assess the relationship between two non-normally distributed continuous variables. P value < 0.05 was considered statistically significant.