1,2-Dipalmitoyl-sn-glycero-3-phosphate (dipalmitoyl phosphatidic acid, DPPA) and the fluorescent dye Cy5 were procured from Xi’an Rui Xi Biotechnology Co. (Xi’an, China). PLGA (8k)-PEG-NH2 was purchased from Xi’an Qiyue Biology (Xi’an, China). MK8353 was procured from MedChemExpress (New Jersey, USA). Dimethyl sulfoxide (DMSO) and N, N’-dimethylformamide (DMF) were acquired from Sigma‒Aldrich and used as received. The DAB (SA-HRP) TUNEL Cell Apoptosis Detection Kit was purchased from Servicebio® (Wuhan, China), and the Annexin V-FITC/PI Apoptosis Kit (#E-CK-A211) was purchased from Elabscience Biotechnology (Wuhan, China). Matrigel were sourced from Corning Incorporated (New York, USA). Dulbecco’s modified Eagle’s medium (DMEM), penicillin‒streptomycin, trypsin, and fetal bovine serum (FBS) were purchased from Invitrogen. All other reagents and solvents were of analytical grade and were used without further purification.
Antibodies and primersThe VEGFA rabbit pAb (19003-1-AP), Angptl2 rabbit pAb (12316-1-AP), ERK rabbit pAb (11257-1-AP) and phospho-ERK rabbit pAb (28733-1-AP) were purchased from Proteintech (Wuhan, China). Cy5-conjugated goat anti-rabbit IgG (H + L) and GAPDH rabbit mAb (GB15004-100) were purchased from Servicebio (Wuhan, China). The Ki67 rabbit pAb (GB111499-100) and anti-rabbit IgG horseradish peroxidase (HRP)-linked secondary mAb (#7074) were purchased from Abcam and Cell Signaling Technology (CST), respectively. The primers used for reverse transcription quantitative polymerase chain reaction (qRT‒PCR) were as follows:
Gene
Forward
Reverse
VEGFA (M)
CTGCTGTAACGATGAAGCCCTG
5GCTGTAGGAAGCTCATCTCTCC
Angptl2 (M)
GCGACTCCTTTACCTGGCACAA
GTTGGAGTGAGCACAGGCGTTA
FGF2 (M)
GGCTGCTGGCTTCTAAGTGT
CCCAGTTCGTTTCAGTGCCA
PTGS2 (M)
CAGGACTCTGCTCACGAAGG
CAGTCCGGGTACAGTCACAC
PD-ECGF (M)
ACGCAGGACTGAGGGATAAC
CAGTGGCTGTCACATCTCGT
VEGFA (H)
TTGCCTTGCTGCTCTACCTCCA
GATGGCAGTAGCTGCGCTGATA
Angptl2 (H)
AGACGCCTGGATGGCTCTGTTA
AGTTGCCTTGGTTCGTCAGCCA
FGF2 (H)
AGCGGCTGTACTGCAAAAACGG
CCTTTGATAGACACAACTCCTCTC
PTGS2 (H)
CGGTGAAACTCTGGCTAGACAG
GCAAACCGTAGATGCTCAGGGA
PD-ECGF (H)
CACAGGAGGCACCTTGGATAAG
CTGCTCACTCTGACCCACGATA
Preparation and characterization of NPsDPPA was dissolved in methanol in a water bath at 65 °C to obtain a DPPA solution. Moreover, MK8353 was dissolved in DMSO to obtain an MK8353 solution. First, the DPPA solution was slowly dripped into a glass vial containing 10 mL of water and continuously stirred at 1200 rpm while maintaining a constant temperature of 65 °C. After the mixed solution was continuously stirred for approximately 1–2 min, it was transferred to a 100 kDa molecular weight (MW) filter (Amicon filter) for purification. The mixture was subsequently centrifuged at 2800 rpm to obtain the NPs-DPPA. The mixture was aspirated, and the volume was adjusted with sterile water. The DPPA solution at a concentration of 8 mg/mL and the MK8353 solution at a concentration of 20 mg/mL were mixed at a volume ratio of the DPPA solution to the MK8353 solution of 250 µL:10 µL. The mixture was slowly dripped into a glass vial containing 5 mL of water and continuously stirred at 1200 rpm at a constant temperature of 65 °C for approximately 5 min. The mixed solution in the glass vial was subsequently transferred to a 100 kDa molecular weight (MW) filter (Amicon filter) for filtration. The mixture was centrifuged at 3000 r/min to obtain the NP-AE, which was aspirated, and the volume was adjusted with sterile water to obtain the NP-AE solution. PLGA-ERKi was synthesized using the same method as that for NP-AE. Then, we analyzed the NP-AE using a transmission electron microscopy (TEM). Briefly, 10 µL of freshly prepared nanoparticle solution was dropped onto a copper grid and allowed to stand for 5 min. Subsequently, filter paper was used to absorb the excess liquid. Then, 10 µL of 2% uranyl acetate was added dropwise for negative staining for 5 min. After filter paper was used to absorb the excess liquid, the sample was allowed to dry overnight in the dark. TEM was used to observe and measure the diameter of the NPs. Next, 10 µL of the freshly prepared nanoparticle solution was diluted to 1 mL with deionized water, and the nanoparticles were measured with a Malvern particle size analyzer (DLS). Then, ultraviolet‒visible spectroscopy was used to analyze the composition of the NPs. The encapsulation efficiency of the nanoparticles was determined through fluorescence spectroscopy and ultraviolet‒visible absorption spectroscopy. The drug release profile of the NPs was subsequently determined.
Cell cultureCAL-27 and SCC-7 oral cancer cells and human umbilical vein endothelial cells (HUVECs) were obtained from FuHeng Biology (ATCC, Shanghai). CAL-27 cells were cultured in DMEM, SCC-7 cells were cultured in DMEM/F12, and HUVECs were cultured in ECM. All culture media were supplemented with 10% fetal bovine serum (FBS), penicillin (100 units/mL), and streptomycin (100 µg/mL). The cells were maintained in a humidified cell culture chamber with 5% CO2 at 37 °C.
In vitro cellular uptake and lysosomal escapeNP-AE loaded with Cy5 was prepared according to the preparation method of NP-AE. CAL-27 cells labeled with the mitochondrial fluorescent dye GFP (1 × 10⁵ cells) were seeded in glass-bottom cell confocal culture dishes (Ø15 mm; Nest, Wuxi, China) and incubated for 24 h to allow them to adhere to the wall. Subsequently, 25 µL of the prepared NP-AE-Cy5 was added. After an incubation at 37 °C for 0.5, 1, 4 and 8 h, the samples were washed three times with PBS, fixed with 4% (w/v) paraformaldehyde (PFA), counterstained with Hoechst to label the cell nuclei, and then photographed using an Olympus Fluoview 1000 confocal microscope (Olympus Imaging Corporation, Tokyo, Japan).
Detection of apoptosisCAL-27 and SCC-7 oral cancer cells were seeded in 6-well plates at a density of 50,000 cells per well and incubated at 37 °C for 24 h. Then, NPs-DPPA (with a final concentration of 120 µg/mL), MK8353, PLGA-ERKi and NP-AE (with a final MK8353 concentration of 1/10 of the IC50 value) were added to the culture medium. After an incubation at 37 °C for 48 h, the cell supernatants were collected. The cells were subsequently washed twice with PBS and digested with trypsin, after which 10 µL of PI and Annexin V dyes were added to the flow cytometry tubes. After an incubation at 4 °C for 15 min, apoptosis was detected using a flow cytometer. The total apoptosis rate (%) was determined by flow cytometry using Annexin V-FITC/PI dual staining, where early apoptotic cells (Annexin V+/PI-) and late apoptotic cells (Annexin V+/PI+) were quantified and summed.
In vitro cell proliferation assayCAL-27 and SCC-7 oral cancer cells were seeded in 24-well plates (10 000 cells per well), and NPs-DPPA, MK8353, PLGA-ERKi and NP-AE were added to the culture medium according to the methods described above. Following a 24-hour incubation period at 37 °C, the cells were rinsed with phosphate-buffered saline (PBS) and then incubated with fresh medium. At specific predetermined time intervals, cell viability was evaluated using the Alamar blue assay, and the fluorescence intensity was quantified with a Synergy HT multimode microplate reader (Bio-Tek, USA). After each measurement, the Alamar blue reagent was replaced with fresh medium to ensure accurate and continuous monitoring of the cell viability and fluorescence intensity.
Colony formation assayCAL-27 and SCC-7 oral cancer cells were seeded in 6-well plates at a density of 1000 cells per well and allowed to attach for 24 h. Subsequently, the cells were treated with NPs-DPPA, ERKi, PLGA-ERKi and NP-AE according to the methods described above. After 48 h of treatment, the cell culture medium was changed every 3 d. After 14 d, the clones were stained with crystal violet, imaged, and counted using ImageJ software.
Tube formation assayA 48-well plate was coated with 300 µL of Matrigel and then incubated at 37 °C for 1 h. Next, 200 µL of ECM culture medium was added to each well. A total of 50,000 HUVECs were seeded into each well, and simultaneously, NPs-DPPA, ERKi, PLGA-ERKi and NP-AE were added to the culture medium. After an incubation at 37 °C for a period of 6 to 8 h, the cells were stained with calcein-AM in accordance with the manufacturer’s guidelines and photographed using the 10× objective of an Olympus IX81 microscope.
Sample collection and proteomic analysisThe sample was ground with liquid nitrogen into a cell powder and then transferred to a 5-mL centrifuge tube. Afterward, four volumes of lysis buffer (8 M urea, 1% protease inhibitor cocktail) were added to the cell powder, followed by sonication for three minutes on ice using a high-intensity ultrasonic processor (Scientz) (Note: For PTM experiments, inhibitors were also added to the lysis buffer, e.g., 3 µM TSA and 50 mM NAM to maintain acetylation and 1% phosphatase inhibitors to maintain phosphorylation). The remaining debris was removed by centrifugation at 12,000 × g at 4 °C for 10 min. Finally, the supernatant was collected, and the protein concentration was determined with a BCA kit according to the manufacturer’s instructions. Then, the sample was slowly added to a final concentration of 20% (m/v) TCA to precipitate the protein, vortexed to mix and incubated for 2 h at 4 °C. The precipitate was collected by centrifugation at 4500 × g for 5 min at 4 °C. The precipitated protein was washed with precooled acetone 3 times and dried for 1 min. The protein sample was then redissolved in 200 mM TEAB and ultrasonically dispersed. Trypsin was added at a 1:50 trypsin-to-protein mass ratio for the first digestion overnight. The sample was reduced with 5 mM dithiothreitol for 30 min at 56 °C and alkylated with 11 mM iodoacetamide for 15 min at room temperature in the dark. Finally, the peptides were desalted on a Strata X SPE column.
The tryptic peptides were dissolved in solvent A and directly loaded onto a custom-made reverse-phase analytical column (25 cm in length, 100 μm i.d.). The mobile phase consisted of solvent A (0.1% formic acid, 2% acetonitrile/in water) and solvent B (0.1% formic acid in acetonitrile). Peptides were separated with the following gradient using a constant flow rate of 500 nl/min on a NanoElute UHPLC system (Bruker Daltonics): 0–14 min, 6–24% B; 14–16 min, 24–35% B; 16–18 min, 35–80% B; and 18–20 min, 80% B. The peptides were exposed to a capillary source followed by mass spectrometry on a timsTOF Pro mass spectrometer. The electrospray voltage applied was 1.75 kV. The precursors and fragments were analyzed with the TOF detector. The timsTOF Pro instrument was operated in data-independent parallel accumulation serial fragmentation (dia-PASEF) mode. The full MS scan was set as 300–1500 V (MS/MS scan range), and 20 PASEF (MS/MS mode)–MS/MS scans were acquired per cycle. The MS/MS scan range was set as 400–850, and the isolation window was set as 7 m/z. The DIA data were processed using the DIA-NN search engine (v.1.8).
Western blottingThe same amounts of proteins, which were quantified using a bicinchoninic acid (BCA) protein assay kit (Pierce/Thermo Scientific) according to the manufacturer’s instructions, were loaded onto sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE) gels and then separated by means of electrophoresis. Once the protein was transferred from the gel to a polyvinylidene difluoride (PVDF) membrane, the membrane was blocked with 3% bovine serum albumin (BSA) in a PBS solution containing 0.1% Tween 20 (PBST) for one hour. Next, primary antibodies (for ERK, P-ERK, Angptl2, VEGFa and GAPDH) were added and incubated with the membranes at 4 °C overnight. After the membranes washed with PBST three times, an anti-rabbit IgG HRP-linked secondary antibody was added and incubated with the membranes at 4 °C for 1 h. Finally, protein expression was detected using an enhanced chemiluminescence detection system after the membrane was washed with PBST three times again.
Orthotopic xenograft model of tongue OSCC and the utilization of NPsAll animal experiments in this study were conducted according to the guidelines and regulations approved by the Institutional Animal Ethics Committee of the Laboratory Animal Center of Sun Yat-sen University (License number: #AP20240112). Luciferase-labeled SCC-7 cells were utilized to prepare tumor xenografts. Specifically, luciferase-labeled SCC-7cells (5.0 × 105) were implanted into the left edge of the tongue of BALB/c nude mice (female, 6 weeks old, weighing 18–20 g) to establish an orthotopic xenograft model of oral squamous cell carcinoma (OSCC). The tumors were measured weekly using the IVIS system. Once the tumor was detected by the IVIS system and exhibited luciferase luminescence, NPs were prepared for treatment. The NPs were administered via a tail vein injection every 2 days for a total of 3 administrations. Subsequently, luciferase luminescence of the mouse tongue tumors was detected weekly, and the weights of the mice were measured simultaneously. After 3 weeks, the tumors and peripheral blood were collected for further examination. The abbreviations for all the treatment groups are defined in Supplementary Table S3.
Patient-Derived xenograft (PDX) model and the utilization of NPsFor the establishment of a patient-derived xenograft (PDX) model of OSCC, a particular OSCC patient was chosen. The tumor tissues of OSCC patients (Figure S7) were cut into small pieces and subcutaneously transplanted into the upper right side of the back of NSG mice (female, 5 weeks old, weighing 16–18 g). When the tumor volume reached approximately 60 mm³, treatment with various NP components was administered. The NPs were delivered through a tail vein injection at an interval of 2 days, with a total of 3 injections. The mice were euthanized 20 days after the commencement of treatment. The tumors were subsequently collected for immunohistochemical (IHC) detection. The organs and peripheral blood were also harvested for the toxicity assessment.
PharmacokineticsHealthy normal male BALB/c mice were randomly divided into two groups (n = 3) and administered an intravenous injection of either (i) free MK8353-Cy5 or (ii) NP-AE-Cy5 at a Cy5 dose of 50 µg per mouse. At predetermined time intervals, 20 µL of orbital vein blood was collected into a tube containing heparin and mixed with 80 µL of water. The fluorescence intensity of Cy5 in the blood was measured with a Synergy HT multimode microplate reader.
BiodistributionMice bearing orthotopic SCC-7 tumors were used to investigate tumor penetration and accumulation. Free MK8353-Cy5 was encapsulated in NPs-DPPA (NP-AE-Cy5). Then, the mice were intravenously injected with NP-AE-Cy5 (a dose equivalent to 50 µg of Cy5, n = 3). Whole-body optical imaging was performed after 24 h using an IVIS Lumina III (Perkin-Elmer, USA) imaging system (excitation/emission, 640/670 nm). The mice were sacrificed, and the major organs, muscle and tumors were obtained and imaged.
Blood and histological analysesHealthy male BALB/c mice were randomly divided into five groups (n = 3) and administered an intravenous injection of either (i) PBS, (ii) ERKi, (iii) NPs-DPPA (iv) PLGA-ERKi or (v) NP-AE at a DPPA dose of 1 mg per mouse and/or a MK8353 dose of 5 mg/kg, while free MK8353 was administered orally. After three daily treatments, blood was collected 24 h after the final injection, and serum was isolated for measurements of the levels of representative blood parameters (ALT, AST, ALP, creatinine, urea, and total protein).
Statistical analysesGraphPad Prism software version 8 (GraphPad, San Diego, CA) was used to conduct the statistical analysis and create graphs. The data are presented as the mean values ± the standard errors of the means (SEMs). The sample sizes for each statistical test are specified in the corresponding figure legend. Statistical significance was evaluated between groups via two-tailed Student’s t test and one-way ANOVA. A P value < 0.05 was regarded as statistically significant.
Comments (0)