Animals

Gli2fl/fl and Gli3fl/fl mouse strains were purchased from Gem Pharmatech Co., Ltd (China). Gli1-CreER and B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J were kindly given by Dr. Hu Zhao, Chinese Institute for Brain Research, Beijing. K14-CreER were purchased from Cygen Biomodels, LLC (China). Tamoxifen (T5648, Sigma, USA) was dissolved in corn oil (20 mg/mL, A561403, Ambeed, USA) and administered via intraperitoneal injection (i.p.) for CreER activation at P3.5 (1.5 mg per 10 g). All neonatal pups including both control and mutant mice received the same dose of tamoxifen. SRI-011381 (HY-100347, MedChemExpress, USA) was dissolved in DMSO at 20 mg/mL and stored at −80 °C for long-term use. Control mice were injected with vehicle solution containing 40% PEG300 and 5%Tween-80, Gli1-CreER;Gli2fl/fl;Gli3fl/fl mice were injected with SRI-011381 via i.p. at a final dosage of 10 mg/kg every two days from P5.5 to P21.5. For clarity, Gli2fl/fl;Gli3fl/fl mice were designated as the control group in this study.

All animals were maintained under specific-pathogen-free (SPF) conditions at 20-26 °C; 10%-70% relative humidity, and a 12 h light/dark cycle, with free access to standard water and feeds. Animal experiments received approval from the Research Ethics Committees of the West China School of Stomatology, Sichuan University (WCHSIRB-AT-2025-410) and complied with ARRIVE2.0 guidelines.

Micro-CT

All mandibles were scanned using a SCANCO μCT45 (Switzerland) device with the following parameters: voxel size: 10 μm, energy: 55 kVp, intensity: 145 μA. Root length measurements and three-dimensional (3D) reconstructions of molars were performed using Mimics software. Root length was defined as the vertical distance between the furcation region and the apical region of the root.

Histological and immunofluorescence staining

Mouse mandibles were collected and fixed in 4% paraformaldehyde (PFA) at 4 °C for 24-48 h,and then decalcified in 10% EDTA (Biosharp, China) for 1-3 weeks. For histological staining, the dental tissues were dehydrated through a graded ethanol series, embedded in paraffin, and sectioned at 5 μm using a microtome. The tissues were stained with hematoxylin and eosin following the manufacturer’s protocol (G1120, Solarbio, China). For immunofluorescence staining, the mandibles were dehydrated in 15% sucrose for 2 h and 30% sucrose overnight, then embedded in OCT (6502, Epredia, USA) and prepared into 10 μm sections. The cryosections underwent antigen retrieval at 95 °C for 10 min if necessary, followed by incubation in blocking solution (FP1012, PerkinElmer) for 1 h at room temperature. Subsequently, they were incubated with primary antibodies at 4 °C overnight and cross-reacted with secondary antibodies for 1 h. Images were acquired using a STELLARIX5 confocal microscope (Leica, Germany). The primary antibodies used were as follows: tdTomato (AB8181, SICGEN, Portugal), Periostin (ab14041, Abcam, UK), Sp7 (ab209484, Abcam, UK), p-SMAD2 (44-24 G, Invitrogen, USA), p-SMAD3 (ET1609-41, Huabio, China), and Ki67 (ab15580, Abcam, UK). The secondary antibodies used were as follows: Alexa FluoRTM 488 goat anti-rabbit (1:400, A-11034, Invitrogen, USA), Alexa FluoRTM 555 goat anti-rabbit (1:400, RGAR003, Proteintech, China).

RNAscope in situ hybridization

Cryosections were prepared at a thickness of 10 μm, and RNAscope staining was performed using RNAscope Multiplex Fluorescent Kit v2.0 (323100, Advanced Cell Diagnostics, USA) or PinpoRNATM Multiplex Fluorescent RNA kit (PIF3000, Pinpoease, China). According to the manufacturer’s protocol, sections were pretreated with H2O2 for 15 min, subjected to antigen retrieval at 95 °C for 10 min, and treated with protease for 20 min at 40 °C. Then probes were hybridized to sections for 2 h at 40 °C, and paired with TSA Vivid Fluorophore 520 (PG-323271, PerkinElmer), 570 (PG-327232, PerkinElmer), or 650 (PG-323273, PerkinElmer). Images were acquired using a STELLARIX5 confocal microscope (Leica). Probes were synthesized as follows: Probe-Mm-Gli1 (311001), Probe-Mm-Gli2 (405771), Probe-Mm-Gli3 (445511), Probe-Mm-Dspp (448301), Probe-Mm-Acvr2b (114811).

TUNEL assay

A TUNEL BrightRed Apoptosis Detection Kit (A113, Vazyme, China) was used to detect apoptosis according to the instructions.

Bulk RNA sequencing

The mesenchyme of the first molar was separated carefully from control, Gli1-CreER;Gli2fl/fl, Gli1-CreER;Gli3fl/fl, Gli1-CreER;Gli2fl/fl;Gli3fl/fl mice at P5.5 with microforceps under a stereo microscope (Leica, Germany). RNA was extracted using the FastPure cell/tissue total RNA isolation kit (RC101-01, Vazyme, China) and stored at -80 °C. DNA libraries were prepared with AMPure XP system (Beckman Coulter, Beverly) and qualified using an Agilent 2100 bioanalyzer, subsequently they were submitted for sequencing on the Illumina NovaSeq 6000. Raw sequencing data quality was assessed using FastQC software. Gene-level quantification was performed using Feature Counts (v1.5.0-p3), and FPKM values were calculated to quantify gene expression levels. Differential expression analysis was performed with significance thresholds set at P < 0.05 and |log2(fold change)| >1.5.

Western blot

Total protein from mesenchymal tissue of the first molar at P5.5 was extracted by ultrasonic lysis using the Total Protein Extraction Kit (KGB5303, KeyGEN, China) for 30 min at 4 °C. Subsequently, the supernatant was collected and denatured by heating at 99 °C for 10 min. The extracted proteins were loaded onto 7.5%-10% polyacrylamide gels (PG212, Epizyme, China) and transferred to PVDF membranes (ISEQ00005, Millipore, Germany). Membranes were blocked in 5% non-fat dry milk for 1 h and incubated with primary antibodies on a shaker overnight at 4 °C. After washing in TBST for three times, the membranes were incubated with secondary antibodies for 1 h and the bands were detected using a ChemiDoc Imaging System (Bio-Rad, USA). The following primary antibodies were used: p-SMAD2 (18338 T, Cell Signaling Technology, USA), p-SMAD3 (ET1609-41, Huabio, China), SMAD2/3 (14L86C22, Enzyme, China), β-actin (EM21002, Huabio, China). The secondary antibodies included HRP-conjugated goat anti-rabbit IgG polyclonal antibody (HA1001, Huabio, China), HRP-conjugated goat anti-mouse IgG polyclonal antibody (HA1006, Huabio, China).

Quantitative reverse transcription PCR (RT-qPCR)

Total RNA from mesenchymal tissue of the first molar at P5.5 was extracted using the FastPure cell/Tissue Total RNA isolation kit (RC101-01, Vazyme, China) and reverse transcribed to cDNA using HiScript®III RT Super Mix (R323-01, Vazyme, China). qRT-PCR was conducted using Taq pro Universal SYBR qPCR Master Mix (Q712-02/03, Vazyme, China) on a LightCycler480 system (Roche, Sweden). The relative expression levels of genes were calculated with the 2-ΔΔCt method. Primers sequences used for RT-qPCR were listed below: Gapdh: Forward: AAGAAGGTGGTGAAGCAGGCATC; Reverse: CGGCATCGAAGGTGGAAGAGTG. Acvr2b: Forward: ACAAGAAGATGAGGCCCACG; Reverse: GCTCTTCTACACAGCCTGCA.

CUT&Tag

The mesenchyme of the first mandibular molars from wildtype mice at P3.5 was isolated using microforceps under a stereomicroscope (Leica, Germany). Nuclei were then isolated and purified using Bioyou Nuclei Isolation Kit (52009-10, WEMatrix Biotechnology, China) and numbered with Trypan Blue (T10282, Invitrogen, USA). For CUT&Tag, libraries were prepared according to the manufacturer’s instructions of Hyperactive Universal CUT&Tag Assay Kit for Illumina Pro (TD904, Vazyme, China) and sequenced on the Illumina NovaSeq 6000 platform with paired-end reads of 150 bp (performed by Hangzhou Kaitai Biotechnology Co., Ltd.). Raw reads were filtered using fastp (v0.23.4) and subsequently aligned to the mouse reference genome (GRCm38/mm10) using Bowtie2 (v2.5.3). Peak calling was performed using MACS3 (v3.0.1) with P < 0.05. Differential peaks were annotated using ChIPseeker, and motif analysis was conducted using MEME with E-value ≤ 0.05. For qPCR validation, stop buffer was added to release DNA fragments by incubation at 95 °C for 5 min, and the eluted DNA was subsequently used for qRT-PCR analysis with locus-specific primers. Relative enrichment over the IgG control was calculated using the 2-ΔΔCt method. The antibodies used for CUT&Tag were: Gli2 (1:50, NB-600-874, Novus Biologicals, USA), Gli3 (5 μg/106 cells, AF3690, R&D systems, USA), rabbit control IgG (1:50, AC005, Abclone, China), goat anti-rabbit IgG H&L (Ab207, Vazyme, China), and rabbit anti-goat IgG (H + L) (1:100, AS081, Abclone, China). The sequence of qPCR primers designed to detect the Acvr2b binding site were: Forward: AGTGACTGGCTTTTCCAGTGTA; Reverse: CAGATCCCTCCATTTCAGATGTTAC.

Statistical analysis

All data are presented as mean ± standard deviation (SD) and analyzed using GraphPad Prism10.0. Statistical significance was assessed using two-tailed Student’s t-test for two-group comparisons or one-way ANOVA for multiple comparisons. Immunofluorescence staining was quantified using ImageJ software. At least three independent experimental replicates were conducted, and representative images were selected. P < 0.05 was considered statistically significant.