We downloaded transcriptional RNA expression profiling from the Gene Expression Omnibus database (GEO) (https://www.ncbi.nlm.nih.gov/geo/) for analysis. GSE65682 was performed as the training set, GSE75065 as the validation set for sepsis diagnosis, and GSE185263 as the validation set for sepsis prognosis. In this study, pediatric samples, non-whole blood samples, and datasets with too small a sample size (samples < 50) were excluded from the selection session. GSE65682 contained a total of 802 samples, with 479 septic patients remaining and 42 healthy controls after excluding unidentified samples. GSE57065 consisted of 28 septic patients and 25 healthy controls. GSE185263 consisted of 348 septic patients and 44 healthy controls. Both GSE65682 and GSE185263 were clinical data sources for survival analysis. We normalized the microarray sequencing data to enable comparability between the two groups. Probes with missing gene symbols were removed. Prior to formal analysis, we performed batch effect correction on the data using the normalizeBetweenArrays function from the limma package to minimize its impact on the research findings.
Screening the differentially expressed FRGs between sepsis and controlThe 621 ferroptosis-related genes (FRGs) were acquired from the FerrDb V2 database (http://www.zhounan.org/ferrdb/current/), including 264 drivers, 238 suppressors, 9 markers, and 110 unclassified genes, for a total of 564 unduplicated FRGs [24]. These FRGs from FerrDb were selected for subsequent analysis because they are regulatory factors to play roles in ferroptosis as evidenced by prior literature, with curated relevance or biological roles in ferroptosis. We conducted differential analysis of the data between the sepsis and control for GSE65682 via the limma package in R software (v 4.2.1) to obtain differentially expressed genes (DEGs), applying thresholds of p.adj < 0.05 and |log2FC|> 1, which were subsequently intersected with 564 unduplicated FRGs to filter differentially expressed FRGs. The Venn diagram allows the intersection of the two parts to be observed [25]. We can observe the upregulated and downregulated changes of the FRGs by using the heatmap and volcano map.
Functional enrichment analyses and protein–protein interaction (PPI) network analysis of differentially expressed FRGsGene ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis revealed the enriched signaling pathways of the genes and their associated regulatory molecules by clusterProfiler package. GO terms comprise biological process (BP), cellular component (CC), and molecular function (MF). PPI plays a role in observing the complex interaction of proteins with each other. The FRGs were uploaded to the STRING website (www.string-db.org/) to predict the contact between genes, and the minimum interaction score was set to a low confidence level of 0.15. The PPI network was plotted by Cytoscape software (v.3.9.0), using betweenness centrality (BC) as a measure of relative importance, which demonstrates the interconnections and significance ranking within the differentially expressed FRGs.
Immune infiltration analysisWe visualized and compared the relative proportions of 22 immune cells in the sepsis and control groups, and in the survivor and non-survivor groups of septic patients, using the CIBERSORT algorithm. Differential expressions of immune cells between comparative groups could be remarked. By Spearman correlation analysis, it is possible to quantify whether there is a relationship between key FRGs and immune cells and the intensity of the correlation.
Construction of random forest model to identify hub FRGsSeveral studies have shown the application of machine learning models to predict diseases with FRGs, such as ulcerative colitis [26]. Based on the FRGs yielded from the previous analysis, GSE65682 was randomly divided into a training set and a testing set, consisting of 312 and 209 samples, respectively. The training set is intended to construct a random forest model for prediction, and the testing set is applied to verify the accuracy and robustness of the model. A series of indicators, including accuracy, balanced accuracy, precision, recall, F1-score, and Kappa are calculated to assess the excellence of the model’s prediction effectiveness. After determining the parameters (mtry = 3, ntree = 500), the diagnostic performance of the model can be informed by the classification ROC. Meanwhile, the most important genes are obtained according to the MeanDecreaseGini, and the top five hub FRGs are selected for validation with GSE57065.
Survival analysisWe performed univariate Cox proportional hazards regression on the survival data of GSE65682 and obtained differentially expressed prognosis-related FRGs by taking the intersection of screened genes with differentially expressed FRGs. This was followed by a log-rank test, and Kaplan–Meier survival curves were plotted. The remaining hub FRGs were validated for their association with sepsis prognosis by GSE185263, illustrating the predictive performance of FRGs that were statistically significant between the survivor and non-survivor groups by ROC.
Nomogram establishmentThe clinical data of GSE65682 such as gender, age, and FRGs gained from the survival analysis were used as variables of the nomogram to observe the contribution of different features on the 7-day and 14-day survival probability of sepsis by the rms package. Each variable value is assigned a score, and the total score of all scores summed for a given patient corresponds to the 7-day and 14-day survival probability. The calibration curve reflects how well the predicted condition fits the actual condition and enables evaluation of the model’s accuracy.
Target gene prediction of the transcription factorWe used GTRD, ChIP-Atlas, and GTEx database websites to predict the target genes of the transcription factor MAFG, and then intersected them with differentially expressed FRGs in GSE65682 and verified the expression differences of the screened genes in normal and sepsis samples by RT-qPCR. Meanwhile, the interaction network between MAFG and its target genes in GTRD and ChIP-Atlas databases was presented via TF Target Finder software (https://jingle.shinyapps.io/TF_Target_Finder/), according to the criteria of p-value < 0.05 and |log2FC|> 1.
Analysis of scRNA-seq data of sepsisWe analyzed scRNA-seq data from GSE175453 containing samples from five healthy participants and four sepsis patients using the Seurat package in R software. For doublets removal and quality control, we filtered low-quality cells based on the criteria of nFeature_RNA > 200, nFeature_RNA < 6000, and nCount_RNA > 1000, percent.mt < 10%, and percent.HB < 3%. This was followed by normalization, the selection of 2000 VariableFeatures, and the standardization of gene expression. The data integration and correction of batch effects were performed by Harmony. Furthermore, we used UMAP to cluster and visualize the data in the high-dimensional space for dimensionality reduction, and then manually annotated the clusters with the markers corresponding to the specific cell type previously reported in the literature. We ultimately annotated monocytes (CD14, LYZ, S100A9), CD4 + T cells (CD3D, CD4), NK cells (KLRC1, FCGR3A, GNLY), platelets (ITGA2B, GP1BA), macrophages (CD68, CD163), CD8 + T cells (CD3D, CD8A), NKT cells (CD3, NKG7), B cells (CD79A, MS4A1), neutrophils (MPO, CD66B), and plasma cells (TNFRSF17, SDC1). Using the FindAllMarkers function and setting min.pct = 0.1, logfc.threshold = 0.25, we obtained all the marker genes for each cluster.
Predicting potential functions of MAFG through virtual knockoutWe utilized the R package scTenifoldKnk to analyze the single-cell dataset GSE175453 for predicting potential gene functions through virtual knockout [27]. This method enables prediction of whole-genome expression profile changes when a specific gene is knocked down in a cell population. First, we constructed a denoised gene regulatory network from the sepsis sample expression matrix, and we set the regulatory edges corresponding to the target KO gene MAFG to zero to generate a simulated knockout network. Next, we employed manifold alignment to embed both the original network and the simulated KO network into a latent space. By calculating expression differences of genes between the two networks, we identified differentially regulated genes sensitive to the knockout. Finally, we performed GO enrichment analysis on these genes to infer potential functions of MAFG based on the results.
Sample collectionWe collected 10 whole blood samples from normal individuals and 7 whole blood samples diagnosed with sepsis in the Department of Laboratory Medicine, the Third Xiangya Hospital of Central South University, and placed them in anticoagulation tubes for subsequent experiments. The procedure was reviewed by the Ethics Committee of the Third Xiangya Hospital of Central South University (No. 25034) on January 13, 2025. The whole process was operated according to the principles of the Declaration of Helsinki.
PBMC extractionThe whole blood samples were diluted in sterile, enzyme-free PBS and slowly added to Ficoll-Paque PLUS (17,144,003–1, Cytiva, USA), and the mononuclear cell layer was separated by centrifugation at 300 g for 30 min. PBS was added for washing, and the supernatant was discarded after centrifugation at 300 g for 10 min, which was repeated twice to obtain ultimate peripheral blood mononuclear cells.
RNA extraction and RT-qPCRTotal RNA from the cells was extracted by adding 500 μl of Trizol reagent (15596018CN, Invitrogen, USA) to each sample, and the concentration and purity of each RNA sample were determined by a NanoDrop®ND-1000 spectrophotometer (Thermo Fisher, USA). Next, cDNA was synthesized by reverse transcription from 1 µg RNA (RK20433, ABclonal, China) and amplified by qPCR using the SYBR Green Mix Kit (RK21219, ABclonal, China). The relative expression of target genes was then estimated using Ct values detected by a real-time fluorescent quantitative PCR system (LightCycler480, Roche, USA). GAPDH was used as an internal reference gene for normalization, and 2−ΔΔCT was applied to assess relative gene expression. The primer sequences (Sangon Biotech, China) synthesized were as follows: MAFG: Forward: TCAGATTTCAGAGGAATACCCAGCAG, Reserve: TGATCACCAGTCAGAAGTGTACACAC. TXN: Forward: AGACTCCAGCAGCCAAGATG, Reserve: AGCAACATCATGAAAGAAAGGCT. GAPDH: Forward: AATGGGCAGCCGTTAGGAAA, Reserve: GCGCCCAATACGACCAAATC.
Statistical methodsAll statistical analyses were completed using R software (v 4.2.1) and SPSS 25.0. The univariate Cox regression analysis and the log-rank test were conducted to filter the genes related to prognosis by the p-value and hazard ratios. The ROC demonstrates the efficacy of diagnosing or predicting prognosis in sepsis. Normally distributed data and non-normally distributed data were compared between the two groups by Student’s t-test and Mann–Whitney U test, respectively. The correlation analysis was evaluated by the Spearman correlation coefficient. The p < 0.05 (two-sided) was considered to be statistically significant.
Comments (0)