TIMER 2.0 platform (http://timer.cistrome.org/) and TCGA database (https://portal.gdc.cancer.gov/) were used to analyze the expression profile of CGREF1 in patient samples across various cancer type. GEPIA was utilized to compare CGREF1 expression levels between normal and CRC tissues. A paired analysis of CGREF1 expression was conducted using data from 17 CRC tumor specimens and their adjacent normal tissues obtained from the TCGA database.
Clinical tissue specimensThe human CRC microarray was purchased from AiFang Biological (AF-CocSur2201). The total of 80 CRC tissue samples and paired adjacent normal intestinal epithelial tissues on this microarray were obtained from Hunan Cancer Hospital between January 2018 and October 2018. The use of patient samples and clinical information for this study has been approved by the institutional review board from both Hunan Cancer Hospital and the First School of Clinical Medicine. All patients underwent colectomy without receiving neoadjuvant therapy. The tumors were staged according to the traditional TNM staging system, and additional data were obtained from the pathological reports issued after tumor resection. There were 44 male and 36 female with the age ranging from 31 to 81 years (median: 61 years). The tumor is located in the right colon in 49 patients, left colon in 31 patients. All patients underwent an assessment of the mismatch repair (MMR) status. The mismatch repair (MMR) status was evaluated by immunohistochemistry using a previously constructed tissue microarray containing cores of formalin-fixed paraffin-embedded cancer tissue. Patients were routinely followed up for 5 years after surgery. The death records were up to October 1, 2023; this date was used as the censoring date for the survival analysis. The overall survival rate (OS) was calculated from the date of surgery to the date of death due to any cause.
Statement: The protocol was reviewed and approved by the Institutional Review Board of the Biological Science Ethics Review Committee of Hunan Aifang Biotechnology Co., Ltd. (Approval No. HN20250401). Informed consent was obtained from all participants or their legal representatives prior to sample collection and data acquisition.
Cell culture and siRNA/shRNA knockdown of CGREF1CRC cell lines SW480 and RKO were purchased from the National Collection of Authenticated Cell Cultures (Shanghai, China). They were cultured in RPMI-1640 medium (Gibco, C11875500BT) with 10% fetal bovine. All cell cultures were maintained at 37 °C in a humidified atmosphere containing 5% CO2.
To knock down CGREF1 expression in SW480 and RKO cells, lipofectamine 3000 reagent (Thermo, L3000075) was used to transfect the siRNA (Sangon Biotech) into cells according to the manufacturer’s instructions. The siRNA sequence information is as follows: 5’-GCACAUUGUUCAAGUGGAGAA-3’(sense strand) and 5’-UUCUCCACUUGAACAAUGUGC-3’(antisense strand). The cells were harvested 48 h or 72 h after transfection for qRT-PCR and Western blotting analyses.
A human shRNA sequence (CTGGAGTCTAAGAACACCCAA) specific to CGREF1 was cloned into pLKO.1 to generate pLKO.1-CGREF1-shRNA.
RNA isolation, reverse transcription (RT) and real-time quantitative PCRTotal RNA was isolated from all cell lines and tissues using the Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions.
RT was carried out using the SuperScript First-Strand Synthesis System for qRT-PCR according to the protocol. The primers used included those for CGREF1:5’-ACGATGACAGTGTTAATCCTGC-3’(forward) and 5’-CCTAGTCCCTTTAGGTAGCTCTG-3’(reverse); GAPDH: 5’- ACAGTCAGCCGCATCTTCTT -3’(forward) and 5’-GGATGCCACAGGACTCCAT-3′(reverse). qRT-PCR was performed using the Applied Biosystems 7500 Sequence Detection system, using PerfectStart® Green qPCR SuperMix (Transgen, Beijing, China) containing 5 ng cDNA and 10 pmol of each primer. The cycling conditions consisted of one cycle at 94 °C for 5 min followed by 40 cycles of 95 °C for 30 s and 56 °C for 30 s. Melting curve analysis was conducted for each PCR reaction to confirm the specificity of amplification. Real-time quantitative PCR for target genes was normalized to the geometric mean of housekeeping gene GAPDH and calculated using the 2−ΔΔCT method.
Western blottingEqual amounts of protein were separated by electrophoresis on a 10% SDS-PAGE gel and electrotransferred from the gel to PVDF membrane. After blocking with 5% milk in Tris-buffered saline with Tween (TBS-T) for one hour, the membrane was incubated with primary antibodies against rabbit antibody Anti-CGREF1(1:1000 dilution; Proteintech, 13323-1-AP). A mouse anti-α-Tubulin (Proteintech, 11224-1-AP) monoclonal antibody served as a loading control. Following incubation overnight at 4℃, the membrane was washed with TBS-T and then incubated with secondary antibodies. Finally, the enhanced chemiluminescence detection system was used to visualize the results according to the manufacturer’s protocol.
ImmunohistochemistryParaffin-embedded CRC specimens were cut into 4.0 μm sections and baked at 65 °C for one hour before deparaffinization and rehydration processes. Sections underwent treatment with 3% hydrogen peroxide to quench endogenous peroxidase activity and antigen retrieval via high-pressure steaming in citrate buffer. Non-specific binding sites were blocked by incubation with goat serum for 30 min. Primary antibody anti-CGREF1 (1:200 dilution; Proteintech, 13323-1-AP) was applied and incubated overnight at 4 °C. Secondary biotinylated anti-rabbit IgG was subsequently added, followed by streptavidin–horseradish peroxidase complex incubation. Visualization was achieved using 3,3-diaminobenzidine substrate and counterstaining with hematoxylin. Images were captured under light microscopy after dehydration and mounting procedures. The staining results were independently scored by two pathologists based on the staining intensity (negative = 0, weak = 1, moderate = 2, strong = 3) and proportion of positive cells (0% = 0, 1–10% = 1, 11–50% = 2, 51–80% = 3, 81–100% = 4). The immunoreactivity score (IRS) was calculated by multiplying intensity score by the proportion score of positive cells (Carr et al. 1986).The cases were divided into four groups: Negative, Weak, Moderate, Strong CGREF1expression based on the IRS (IRS 0, 1–3, 4–6, 7–12) (Lindner et al. 2015). The immunohistochemical staining results were correlated with clinicopathological features and survival in CRC patients.
In vitro proliferation and migration assayCells were seeded at a density of 1 × 103 cells per well into 96-well plates and incubated for 24 h. Subsequently, CCK-8 reagent (RABIO, RA9500) was added to each well, followed by a 2-h incubation at 37°C. The absorbance was measured at 450 nm to assess cell viability. DNA synthesis rate was evaluated using the 5-Ethynyl-2’-deoxyuridine (EdU) staining kit (Beyotime), according to the manufacturer’s protocol.
For colony formation assays, 1000 cells were plated in each well of a 6-well plate containing RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS). After two weeks of incubation, colonies were fixed with 4% paraformaldehyde for 30 min and stained with hematoxylin.
In transwell migration assays, cells were subjected to serum starvation for 24 h prior to experimentation. A total of 1 × 10^5 CRC cells were then seeded into the upper chamber of transwell inserts. The lower chambers were filled with DMEM medium (Gibco) containing 20% FBS as a chemoattractant. Following a 24-h incubation period, non-migrating cells in the upper chamber were removed with cotton swabs, and the migrated cells were stained with crystal violet.
For scratch assays, CRC cells (2 × 105 cells per well) were inoculated into 6-well plates and cultured for 24 h. Using a 10-μL sterile pipette tip, wounds were marked along a straight line on the plate. And at 0 h, 24 h, and 48 h, the inverted microscope was used for observation. The migration rate (initial area—remaining area) / initial area × 100% was calculated via ImageJ software.
All experiments were independently repeated three times, and the results are presented as mean ± SEM. Statistical analyses were performed to evaluate the significance of differences between experimental groups.
ImmunofluorescenceCRC cells were inoculated on coverslips and fixed with 4% w:v paraformaldehyde. After washing with PBS, the cells were blocked with a PBS solution containing 0.1% Triton X-100 and 1% bovine serum albumin for 1 h. Then, the cells were incubated with a primary antibody against Alexa Fluor 594-conjugated phalloidin (1:200 dilution; UE, YP0052L). Coverslips were counterstained with DAPI and imaged using a confocal laser-scanning microscope (Olympus FV1000). Data were processed using GraphPad Prism V.9 (GraphPad Software).
Orthotopic mouse metastatic modelWeek-old Balb/C athymic nude (nu/nu) mice (approximately 20 g body weight) were anesthetized and subjected to surgical orthotopic implantation of RKO cells. A suspension of 2 × 10^6 cells in 100 μL of PBS was injected into the cecal wall of each immunodeficient mouse (n = 6 per group). One and a half months post-surgery, mice were euthanized, and individual organs were dissected. The number of macroscopic metastatic lesions was assessed using a stereomicroscope. All animals were maintained under specific pathogen-free conditions. All mouse experiments were approved by the Laboratory Animal Ethics Committee of Shenzhen University and were instruct accordance with good veterinary practice as defined by the Shenzhen University Laboratory Animal Center.
Statement: Based on the the Laboratory Animal Ethics Committee of the Second Affiliated Hospital of Shenzhen University, tumors in mice must not exceed 2000 mm3.
Statistical analysisStatistical analysis was performed with GraphPad Prism V.9 (GraphPad Software). Statistical analyses included Student’s t-test, Wilcoxon-Mann–Whitney test, and two-way ANOVA. Survival curves were plotted by the Kaplan–Meier method and compared using the log-rank test. p < 0.05 was considered statistically significant.
Comments (0)