P2X7 receptor-mediated cGAS-STING pathway activation underlies chronic stress-induced depressive-like behaviors

Mice

Male adult C57BL/6 J mice (8 weeks of age, obtained from Chengdu Dossy Experimental Animal Co, China) were used in this study. All animal procedures were approved by the Animal Ethics Committee of West China Hospital, Sichuan University and were conducted in accordance with local legislation and institutional requirements. Mice had free access to water and food under a 12 h dark/light cycle.

Chronic restraint stress

CRS was conducted over a 14-day period, with mice placed in ventilated 50 mL centrifuge tubes. The daily restraint duration was 3 h for the initial 7 days and increased to 4–5 h for the final 7 days, according to an established protocol [34].

Drug Treatments

For experiments with JNJ-47965567 (#HY-101418, MCE, USA), a selective and brain-penetrant P2X7 receptor antagonist, mice were intraperitoneally injected either with vehicle or JNJ-47965567 (30 mg/kg, dissolved in 200 µL PBS containing 30% SBE-β-cyclodextrin) 4 times per week. For experiments with H-151 (#HY-112693, MCE, USA), a selective inhibitor of STING, mice were intraperitoneally injected either with vehicle or H-151 (10 mg/kg, in 200 µL PBS with 5% Tween-80) 5 times per week. The difference in dosing frequency reflects the distinct pharmacokinetic properties of each compound, as established in previous studies [30, 35].

Behavioral procedures

Open Field Test (OFT) An open field area (50 cm × 50 cm × 50 cm) made of PVC was used to assess spontaneous activity. Movements and locomotor activities of mice were monitored simultaneously in 4 boxes over 10 min with a camera above the arenas, and the EthoVision® XT (Noldus, Netherlands) was used to measure the spontaneous activity of the animals. Total distance and the time spent in the center area were analyzed.

Sucrose Preference Test (SPT)

Mice were singly housed and habituated to two bottles (one water, one 1% sucrose) for 3 days, with bottle positions switched every 12 h. After habituation, mice were deprived of food and water for 12 h (starting at the beginning of the light cycle) to enhance motivation. The sucrose preference test was then conducted over a 12-h period overnight, during which both bottles were available. Food was returned ad libitum after the test. Sucrose preference (%) was quantified as (volume sucrose/(volume sucrose + volume water)) × 100%.

Tail Suspension Test (TST) The tail of each mouse was secured with tape to suspend it around 30 cm above the ground. All the animals were suspended for a total of 6 min, and the duration of immobility was recorded during the last 4 min of the test.

Cell culture and drug treatment

BV2 microglial cells (#CTCC-003–0003, Meisen, China) were cultured in DMEM (#C11995500BT, Gibco, USA) with 10% fetal bovine serum (#10099141C, Gibco, USA), and 1% penicillin–streptomycin solution (#SV30010, Hyclone, USA) under 5% CO2 at 37 °C. To inhibit P2X7R activity, BV2 cells were pre-treated with 20 μM JNJ-47965567 (#HY-101418, MCE, USA) or DMSO for 1 h and subsequently stimulated with 1 μg/mL LPS (#665,778, Sigma, USA) for 15 h.

siRNA transfection

siRNAs were purchased from Genepharma (#D-001910–01–05, Dharmacon). BV2 cells were transfected with 25 nM siP2X7 and scrambled siRNA (siP2X7: 5′UCGAUACCCAUGAUUCCUCTT3′, scrambled siRNA: 5′ AAGTGATGACGACTCTTATGA 3′) by HiPerFect Transfection Reagent (#301,702, QIAGEN, Germany) according to the manufacturer's protocol. After a 48-h transfection period, the transfected cells were treated with 1 μg/mL LPS for 15 h.

Quantitative real-time PCR

Total RNA was isolated from mouse hippocampus or cultured BV2 cell lysates using the RNeasy Kit (#74,134, QIAGEN, Germany) according to the manufacturer's instructions. The concentration and purity of the RNA were determined spectrophotometrically. For reverse transcription, 1 μg of total RNA from each sample was used to synthesize first-strand cDNA in a 20 μL reaction volume using the iScript cDNA Synthesis Kit (#11141ES, Yeasen Biotechnology, China). Quantitative real-time PCR was subsequently performed with the SYBR Select Master Mix (#4,312,704, Thermo, USA) on an ABI 7500 Real-Time PCR System, using specific primers for each target gene. The relative mRNA expression levels were calculated using the 2–ΔΔCt method, with β-actin serving as the reference gene for normalization. The sequences of all primers used are provided in the Supplementary Table.

Western blotting

Total protein was extracted from mouse hippocampus tissues or cultured BV2 cells by lysis in Lysis Buffer (#78,501, Thermo, USA) supplemented with protease (#P8340, Sigma, USA) and phosphatase inhibitors (#G2007, Servicebio, China). The subsequent procedure was conducted as previously described [16]. Antibodies: rabbit anti-P2X7 (1:1000, #APR-004, Alomone Labs, Israel), rabbit anti-cGAS (1:1000, #31,659, CST, USA), rabbit anti-STING (1:1000, #13,647, CST, USA), rabbit anti-p-STING (1:1000, #72,971, CST, USA), rabbit anti-IRF3 (1:1000, #4302, CST, USA), rabbit anti-p-IRF3 (1:1000, #2904, CST, USA), rabbit anti-TIM23 (1:1000, #11,123–1-AP, Proteintech, USA), mouse anti-β-actin (1:5000, #66,009–1-Ig, Proteintech, USA), mouse anti-GFAP (1:5000, #60,004–1-Ig, Proteintech, USA), and HRP-conjugated Affinipure Goat Anti-Mouse IgG (1:5000, #SA00001-1, Proteintech, USA), HRP-conjugated Affinipure Goat Anti-Rabbit IgG (1:5000, #SA00001-2, Proteintech, USA).

Immunofluorescence

Mice were perfused with 0.9% saline and 4% paraformaldehyde under pentobarbitone (1%, 50 mg/kg) anesthesia. Brains were collected, post-fixed, and cryoprotected in 30% (w/v) sucrose solution. Brains were cut using a cryostat in 25 μm-thick sections and kept at −80 °C until use. Frozen sections were blocked in 5% donkey serum or goat serum in PBS containing 0.3% Triton X-100 at room temperature for 1 h. Thereafter, brain sections were incubated at 4 °C overnight with the following primary antibodies: mouse anti-P2X7 (1:100, #sc-514962, Santa Cruz, USA), rabbit anti-p-STING (1:100, #62,912, CST, USA), rabbit anti-IBA1 (1:200, #17,198, CST, USA), goat anti-IBA1 (1:200, #ab5076, Abcam, UK), rabbit anti-GFAP (1:200, #12,389, CST, USA), mouse anti-GFAP (1:200, #3679, CST, USA), rabbit anti-NeuN (1:400, #ab190565, Abcam, UK), mouse anti-NeuN (1:400, #ab104224, Abcam, UK). The sections were then washed in PBS and incubated at room temperature for 1 h with the following secondary antibodies: Alexa-594-conjugated donkey anti-rabbit IgG, Alexa-488-conjugated donkey anti-mouse IgG, Alexa-594-conjugated donkey anti-mouse IgG, Alexa-488-conjugated donkey anti-rabbit IgG (1:500; Invitrogen, USA). DAPI was used for nuclear staining. Confocal microscopy (Olympus, Japan) was used to obtain images.

Immunocytochemistry

BV2 cells were washed once with PBS and fixed in 4% paraformaldehyde. The cells were permeabilized with 0.1% Triton X-100 in PBS for 10 min and then blocked with 5% goat serum in PBS for 30 min at room temperature. After blocking, the cells were incubated overnight at 4 °C with primary antibodies rabbit anti-IRF3 (1:100, #4302, CST, USA), then washed in PBS and incubated with CY3-bound secondary antibodies for 1 h. DAPI was used for nuclear staining. Confocal microscopy was used to obtain images. Then, Image J software was used to measure the ratio of IRF3 expression between the nucleus and the whole cell.

Imaging of dsDNA and mitochondria

To stain dsDNA and mitochondria, cells were incubated with 250 nM PK Mito Orange (a mitochondrial label, #PKMO-1, Genvivo Biotech, China) and 500 ng/ml Picogreen (#12641ES, Yeasen Biotechnology, China) in medium at 37 °C for 20 min, washed with PBS for 30 min. A Nikon N-SIM Structured Illumination microscope (Nikon, Japan) was used to obtain images. ImageJ software was used to observe colocalization between dsDNA and mitochondria.

Transmission Electron Microscope

Mice were perfused with 0.9% saline and 4% paraformaldehyde. Briefly, slices of hippocampus were submerged in 2.5% glutaraldehyde for 24 h at 4 °C before being postfixed for an hour in 1% osmium tetroxide. The samples were then stained with 2% uranyl acetate and subsequently dehydrated in a series of increasing concentrations of ethanol for 10 min each. After being embedded overnight in 100% acetone, the samples were sliced to a thickness of 100 nm and stained with 2% uranyl acetate and lead citrate. Using a Philips Tecnai 10 TEM, images were collected.

Oxygen Consumption Rate Measurements

Oxygen consumption rates were measured using a Seahorse XF24 extracellular flux analyzer (Agilent Technologies, Santa Clara, USA). Briefly, BV2 cells were seeded at a density of 8,000 cells per well in XF24 cell culture microplates and allowed to adhere overnight. Prior to the assay, the cell culture medium was replaced with XF assay medium (#103,576–100, Agilent Technologies, USA) supplemented with 10 mM glucose, 2 mM glutamine, and 1 mM sodium pyruvate, and the cells were incubated at 37 °C in a non-CO₂ incubator for 1 h. Oxygen consumption rates were measured under basal conditions and following the sequential injection of compounds from the Seahorse XF Mito Stress Test Kit (#103,672–100, Agilent Technologies, USA): 1.5 µM oligomycin, 1.0 µM FCCP, 0.5 µM antimycin A and 0.5 µM rotenone. The result was normalized by total protein concentration.

Detection of mtDNA in cytosolic extracts

The cytosol of BV2 cells was isolated using the Mitochondria Isolation Kit (#37,612, QIAGEN, Germany), and the cytosolic fractions were collected without mitochondria. BV2 cells were resuspended in Lysis Buffer. The homogenates were incubated on a rotator for 10 min at room temperature to allow plasma membrane permeabilization, then centrifuged at 2,000 × g for 10 min. Supernatants were transferred to fresh tubes and centrifuged at 20,000 × g for 20 min; supernatants were transferred to fresh tubes to finally yield cytosolic fractions. The cytosolic fraction was split into two tubes (one for total DNA extraction and one for Western blot analysis). The remaining pellet from the first spin contained mitochondria and nucleus, and the pellet was resuspended with PBS and divided into two tubes (one for total DNA extraction and one for Western blot analysis). DNA was then isolated from this fraction using the QIAmp DNA Mini Kit (#69,504, QIAGEN, Germany). 2 ng cytosolic DNA was used for quantitative PCR analysis of mtDNA using gene-specific primers; nuclear β−2-microglobulin (B2m) was quantified from the respective nuclear fraction for normalization [36]. The primer sequences are listed in the Additional file.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 7 software. For comparisons between two groups, the Student's t-test (parametric) or Mann–Whitney U-test (non-parametric) was used. For comparisons involving one independent variable with more than two groups, one-way ANOVA followed by Tukey's post-hoc test was used. For experiments with two independent variables, two-way ANOVA followed by Šídák's or Bonferroni's post-hoc test was used. Normality of data distribution was verified to choose between parametric and non-parametric tests where appropriate. Statistical significance was set at ∗ p < 0.05, ∗ ∗ p < 0.01, ∗ ∗ ∗ p < 0.001.

Comments (0)

No login
gif